View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15907_low_4 (Length: 356)
Name: NF15907_low_4
Description: NF15907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15907_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 5152537 - 5152853
Alignment:
| Q |
19 |
ttatgaaagcgtttgaaaatgagatcttcttcggggagtggaaatgggagggttttggaggtttgaaggaatgtgagtaaagagtttttgagctggaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5152537 |
ttatgaaagcgtttgaaaatgagatcttcttcggggagtggaaatgggagggttttggaggtttgaaggaatgtgagtaaagagtttttgagctggaatt |
5152636 |
T |
|
| Q |
119 |
ggtcgattgaagaagaggtgagggaggatgggtttgaagggtgaattgtgaggttgagtttgattcgtgggaggagtgttaggtctttgtcgatttggat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5152637 |
ggtcgattgaagaagaggtgagggaggatgggtttgaagggtgaattgtgaggttgagtttgattcgtgggaggagtgttaggtctttgtcgatttggag |
5152736 |
T |
|
| Q |
219 |
agggttggttagtgggattagggttaggtcttcttgttcctctagcttcatcctattcatgctcactccctttagaagaagtttcaagtgggatctggtt |
318 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5152737 |
aggggtggttagtgggattagggttaggtcttcttgttcctctagcttcatcctattcatgctcactccctt----agaagtttcaagtgggatctggtt |
5152832 |
T |
|
| Q |
319 |
cgatcttcttacttctgcttc |
339 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
5152833 |
cgatattcttacttctgcttc |
5152853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University