View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15907_low_8 (Length: 293)
Name: NF15907_low_8
Description: NF15907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15907_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 24 - 270
Target Start/End: Complemental strand, 45329010 - 45328764
Alignment:
| Q |
24 |
cacgtggcgtgggcccacataaaactcaactcaaaaccaaatctatgacactattcccaaaacactttaacatcnnnnnnnnnnnnnnnagacaccaaat |
123 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45329010 |
cacgtggcatgggcccacataaaactcaactcaaaaccaaatctatgacactattcccaaaacactttaacatccacacacacaacacaagacaccaaat |
45328911 |
T |
 |
| Q |
124 |
atcatcatttatctttttctctcttgttcagttccatgtcctgtttttcttttcgtcaatggaaaaaaccgaaccctttcttctgatcaaccgtcaaaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328910 |
atcatcatttatctttttctctcttgttcagttccatgtcctgtttttcttttcgtcaatggaaaaaaccgaaccctttcttctgatcaaccgtcaaaat |
45328811 |
T |
 |
| Q |
224 |
ttacaacccttcatttcttccaaatccttcaacgacatagccaccct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45328810 |
ttacaacccttcatttcttccaaatccttcaacgacatagccaccct |
45328764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University