View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_high_37 (Length: 234)
Name: NF15908_high_37
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 32267633 - 32267408
Alignment:
| Q |
1 |
tcctaaaatttgatgtgtcatttattggatgtcatttggtttgtacctaacaaaggtgtgatcgnnnnnnnn--aatataagaaaccactttattaagaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32267633 |
tcctaaaatttgatgtgtcatttattggatgtcatttggttggtacctaacaaaggtgtgatcgttttttttttaatataagaaaccactttattaagaa |
32267534 |
T |
|
| Q |
99 |
gaatgcaagacatattcaatctcaaattaaaccagtgtgcagactttatagtcaaactaggagcttcaaatgatgatgatctgactattcactcc--cac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
32267533 |
gaatgcaagacatattcaatctcaaattaaaccggtgtgcatactttgtagccaaactaggagcttcaaatgatgatgatctgactaatcactcccacac |
32267434 |
T |
|
| Q |
197 |
cctctagagggccttcttcctttgct |
222 |
Q |
| |
|
| || ||||||||||||||||||||| |
|
|
| T |
32267433 |
catccagagggccttcttcctttgct |
32267408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University