View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_high_43 (Length: 216)
Name: NF15908_high_43
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 425473 - 425659
Alignment:
| Q |
22 |
agtccataccaagatagtggtagtagcagatcacatccaacatctatccgcaaacattactgattttattgattcttgcattgcaatgttgtcaattttt |
121 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425473 |
agtccataccaagatagtagtagtagcagatcacatccaacatctatccgcaaacattactgattttattgattcttgcattgcaatgttgtcaattttt |
425572 |
T |
 |
| Q |
122 |
taccaactttagtgttggtnnnnnnnnttatagtgatagtagtgtcatccttcatggctagcccctgtaacttttatattcttcgac |
208 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||| ||||||| | |||||| |
|
|
| T |
425573 |
taccaactttagtgttggtaaaaaaaattatagttatagtagtgtcatccttcatggcgagcccctgtaatttttatagtattcgac |
425659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University