View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_low_22 (Length: 340)
Name: NF15908_low_22
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_low_22 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 229 - 340
Target Start/End: Complemental strand, 46247067 - 46246956
Alignment:
| Q |
229 |
aatatatggtcaatttatttattttttgacaaaaataaatggtcaatttataattgtatatcatgttgcaaattgtgcaattatggttagttaggtagtt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247067 |
aatatatggtcaatttatttattttttgacaaaaataaatggtcaatttataattgtatatcatgttgcaaattgtgcaattatggttagttaggtagtt |
46246968 |
T |
 |
| Q |
329 |
gaattaaccaca |
340 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46246967 |
gaattaaccaca |
46246956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 196 - 288
Target Start/End: Complemental strand, 46247159 - 46247067
Alignment:
| Q |
196 |
taaaataatgcaaagttgtggttaattcatttaaatatatggtcaatttatttattttttgacaaaaataaatggtcaatttataattgtata |
288 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247159 |
taaaataatgcaaaattgtggttaattcatttgaatatatggtcaatttatttattttttgacaaaaataaatggtcaatttataattgtata |
46247067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University