View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_low_23 (Length: 322)
Name: NF15908_low_23
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 16672025 - 16672193
Alignment:
| Q |
1 |
aacgttattgggatcaacaccacaagtgaagcctaattcgatagtgatctactcaaaacagcaaccaagaggagtaagatgagacataagtagaagccta |
100 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672025 |
aacgttattgggatcaacac-acaaccaaagcctaattcaatagtgatctactcaaaacagcaaccaagaggagtaagatgagacataagtagaagccta |
16672123 |
T |
 |
| Q |
101 |
atatgactaatccttttatttatatattcaacaagaattattattagcgatcaagagacctataatcggg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672124 |
atatgactaatccttttatttatatattcaacaagaattattattagcgatcaagagacctataatcggg |
16672193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 209 - 303
Target Start/End: Original strand, 16672231 - 16672326
Alignment:
| Q |
209 |
ataatcgggctcaattataaagttgcaaatacaattagagaaac-nnnnnnnnnnaatactaggttagaagtatgtgtgtaagacaaagagagacg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16672231 |
ataatcgggctcaattataaagttgcaaatacaattagagaaacattttttttttaatacaaggttagaagtatgtgtgtaagacaaagagagacg |
16672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University