View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_low_35 (Length: 253)
Name: NF15908_low_35
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 237
Target Start/End: Original strand, 31527394 - 31527622
Alignment:
| Q |
9 |
agggttataccgatggtagagcagatccaacaattcaaaaccgttcacggcaacatctcacaaaatctaaacgacccttccgaatctagaattcatcaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31527394 |
agggttataccgatggtagagcagatccaacaattcgaaaccgttcacggaaacatctcacaaaatctaaacgacccttccgaatctagaattcatcaat |
31527493 |
T |
 |
| Q |
109 |
ctctcttcctttttagcgttggaagcaacgacatacttgaattctttgataagtttagaaaaaccaatccagacaatgccacacaagaggtgcaacaatt |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31527494 |
ctctcttcctttttagcgttggaagtaacgacatacttgaattctttgataagtttagaaaaaccaatccagacaatgccacacaagaggtgcaacaatt |
31527593 |
T |
 |
| Q |
209 |
cattactactcttatgaatcagtaccaag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31527594 |
cattactactcttatgaatcagtaccaag |
31527622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University