View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_low_37 (Length: 239)
Name: NF15908_low_37
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46246951 - 46246717
Alignment:
| Q |
1 |
taactgtgaattaaattaatcatatctac----cattactcattgatgaacatgattaactaaatataaatttatgttacatattttattttatttaacg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46246951 |
taactgtgaattaaattaatcatatctacgtaccattactcattgatgaacatgattaactgaatataaatttatgttacatattttattttatttaacg |
46246852 |
T |
 |
| Q |
97 |
tatgactcatgacacatcttacaaaaataagataagatttctatctgagttatgttatggattgattacgaaacata-------tttcttcctat-tatg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
46246851 |
tatgactcatgacacatcttacaaaaataagataagatttctatctgagttatgttatggattgattacgaaacatacaagatttttcttcctatatatg |
46246752 |
T |
 |
| Q |
189 |
acatttttaatcaactacttcagctcaaaactaac |
223 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
46246751 |
acttttttaatcaactacttcagctcaaaactaac |
46246717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University