View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15908_low_39 (Length: 237)
Name: NF15908_low_39
Description: NF15908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15908_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 33327937 - 33328169
Alignment:
| Q |
1 |
tatcattattgagttttcttactac-cttcactcttccaaaccatagaagtttcaaaccagcttgctttgttcttgttgactccatagtttatccataag |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327937 |
tatcattattgagttttcttactaatcttcactcttccaaaccatagaagtttcaaaccagcttgctttgttcttgttgactccatagtttatccataag |
33328036 |
T |
 |
| Q |
100 |
tggacttggaccaaacattttatggacgtgggtagggtgtaggaggagcgtaatttcgtaaattgaaccgtggtatttaagtcgtattctagaatcttta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33328037 |
tggacttggaccaaacattttatggacgtgagtagggtgtaggaggagcttaatttcgtaaattgaaccgtggtatttaagtcgtattctagaatcttta |
33328136 |
T |
 |
| Q |
200 |
actttagaaccgtagtatattgtgtgttctgtg |
232 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||| |
|
|
| T |
33328137 |
actttagaaccgtaatatactgtgcgttctgtg |
33328169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University