View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_102 (Length: 239)
Name: NF1590_high_102
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_102 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 239
Target Start/End: Original strand, 16012428 - 16012661
Alignment:
| Q |
7 |
tggacatcatcattctagggattatgtagccattgaatttatatagtagtttacatatctgcaatatgaatttcaaaatgatta-taacttgatatgata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16012428 |
tggacatcatcattctagggattatgtagccattgaatttatatagtagtttacatatctgcaatatgaatttcaaaatgattaataacttgatatgata |
16012527 |
T |
 |
| Q |
106 |
tactaaatattatgtttcttaggtgctccacttacttaattttatgtttttgtgtgaaggcattcattacattaaaaagaggaacccagttagttaagta |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012528 |
tactaaatattatgttgcttaggtgctccacttacttaattttatgtttttgtgtgaaggcattcattacattaaaaagaggaacccagttagttaagta |
16012627 |
T |
 |
| Q |
206 |
tagtcgacaagggaagccaaaactttgtaatttc |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
16012628 |
tagtcgacaagggaagccgaaactttgtaatttc |
16012661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University