View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_116 (Length: 229)
Name: NF1590_high_116
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_116 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 60 - 208
Target Start/End: Complemental strand, 35090005 - 35089859
Alignment:
| Q |
60 |
ctgttgtgtccaagttaccaaaacctcgagaattccaataaaaaacaattatattgggcaataggagatgactcacccctgcaacgggttctgtacggcg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35090005 |
ctgttgtgtccaagttaccaaaacctcgggaattccaataaaaaacaattat--tgggcaataggagatgactcacccctgcagcgggttctgtacggcg |
35089908 |
T |
 |
| Q |
160 |
gcttcccaatccaaagtttctttaatttttgtttatgcttcttagttag |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35089907 |
gcttcccaatccgaagtttctttaatttttgtttatgcttcttagttag |
35089859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University