View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_118 (Length: 226)
Name: NF1590_high_118
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_118 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 38303960 - 38304160
Alignment:
| Q |
17 |
acatataattttgactccctagctaatgagttaaaagtgatcttatttacttgttaaccgagtcaaccggttttgaaattttaacattcttttatgattt |
116 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38303960 |
acatataattttgactcccgaactaatgagttaaaagtgatcttatttacttgttaaccgagtcaactggttttgaaattttaacattcttttatgattt |
38304059 |
T |
|
| Q |
117 |
tttatcaatgggaaagcttagacatttaattaccccacctcttcattcagtctcatgtgtcataaaacaaatggctaatgcatgcaataaggaggttcat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38304060 |
tttatcaatgggaaagcttagacatttaattaccccacctcttcattcagtctcacgtgtcataaaacaaatggctaatgcatgcaataaggaggttcat |
38304159 |
T |
|
| Q |
217 |
c |
217 |
Q |
| |
|
| |
|
|
| T |
38304160 |
c |
38304160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 60 - 111
Target Start/End: Complemental strand, 44166799 - 44166748
Alignment:
| Q |
60 |
tatttacttgttaaccgagtcaaccggttttgaaattttaacattcttttat |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
44166799 |
tatttacttgttaaccgagtgaaccggttgagaaattttaacattcttttat |
44166748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 213
Target Start/End: Complemental strand, 44166737 - 44166699
Alignment:
| Q |
175 |
gtcataaaacaaatggctaatgcatgcaataaggaggtt |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44166737 |
gtcacaaaacaaatggctaatgcatgcaataaggaggtt |
44166699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University