View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_124 (Length: 215)
Name: NF1590_high_124
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_124 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 60 - 198
Target Start/End: Original strand, 42846749 - 42846885
Alignment:
| Q |
60 |
ttgcctggcattctcttatccagttaggtatttctatagcaaacggtgctgttttataggaaattttgaactctattcctcacaa---tacgatgtggga |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
42846749 |
ttgcctggcattctcttatccagttaggtatttctacagcaaacggtgctgttttataggaaattttgaactctattcctcacaactctacaatgtggga |
42846848 |
T |
|
| Q |
157 |
cttaatgtttgaaagcttaaaactgaattagagcattatgct |
198 |
Q |
| |
|
|| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
42846849 |
ct--atgtttgaa---ttaaaaatgaattagagcattatgct |
42846885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University