View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_130 (Length: 209)
Name: NF1590_high_130
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_130 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 3 - 191
Target Start/End: Complemental strand, 713961 - 713773
Alignment:
| Q |
3 |
gatgtcgaagaatatatcagcactgctaaagaaaggaatcagagttctaatctctgatcacgacgttcaatctgacaattttacaatttttactgattaa |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713961 |
gatgtcgaagcatatatcagcactgctaaagaaaggaatcagagttctaatctctgatcacgacgttcaatctgacaattttacaatttttactgattaa |
713862 |
T |
|
| Q |
103 |
gataggcgtatggacaattgattattattcttattagagggaaagttgaacacataactctcttatgtttcttcctcaaaccccaatac |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713861 |
gataggcgtatggacagttgattattattcttattagagggaaagttgaacacataactctcttatgtttcttcctcaaaccccaatac |
713773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 189
Target Start/End: Complemental strand, 713722 - 713680
Alignment:
| Q |
147 |
gttgaacacataactctcttatgtttcttcctcaaaccccaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
713722 |
gttgaacacataactctcttatgtttcttcctcaaaccccaat |
713680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University