View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_131 (Length: 209)
Name: NF1590_high_131
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_131 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 31574873 - 31574789
Alignment:
| Q |
1 |
ctcttttcacttcgtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
85 |
Q |
| |
|
||||||||||||| |||| |||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31574873 |
ctcttttcacttcataaatttctataacaacaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
31574789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 207
Target Start/End: Complemental strand, 31574713 - 31574664
Alignment:
| Q |
158 |
gttctgtgcagttttttgcgttttgtgtttgattattggtgagaatgttg |
207 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| |||| ||||| |
|
|
| T |
31574713 |
gttctgtgcagttttttgtgtttagtgtttgattattggggagattgttg |
31574664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 38029198 - 38029127
Alignment:
| Q |
14 |
gtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactctgg |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38029198 |
gtaaatttctattagatcaactttgtctaaacgaatcaaccactataatcacttggctcttgaaaactctgg |
38029127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 162 - 209
Target Start/End: Complemental strand, 38029049 - 38029002
Alignment:
| Q |
162 |
tgtgcagttttttgcgttttgtgtttgattattggtgagaatgttgcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38029049 |
tgtgcagttttttgcgttttgtgtttgattattggtgagactgttgcg |
38029002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 6509675 - 6509593
Alignment:
| Q |
1 |
ctcttttcacttcgtaaaattctattagatcaactttgtctaaacaaatcaaccactataatcacttggctcttgaaaactct |
83 |
Q |
| |
|
||||||||||||| |||| |||||| | | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6509675 |
ctcttttcacttcataaatttctataacaacaactttgtctaaacgaatcaaccactataatcacttggctcttgaaaactct |
6509593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University