View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_31 (Length: 386)
Name: NF1590_high_31
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 93 - 375
Target Start/End: Complemental strand, 38699820 - 38699542
Alignment:
| Q |
93 |
gattttgcaagttctataatagtttagatgctttagattcacacatcggacgctgaaagttctatgacctccttccttggacgacagataaatttgttat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38699820 |
gattttgcaagttctataatagtttagatgcttaagattcacacatcggacgctgaaagttctatgacctcctt----ggacgacagataaatttgttat |
38699725 |
T |
 |
| Q |
193 |
atatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaacattttcttcattcgatgttggagaagga |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
38699724 |
atatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgcaataaaaaatcatgacaatattttcttcaatcgatgttggagaagga |
38699625 |
T |
 |
| Q |
293 |
cctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttacttatgatttcat |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699624 |
cctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctattccatcacatcagtttacttatgatttcat |
38699542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University