View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_33 (Length: 374)
Name: NF1590_high_33
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 35090057 - 35090423
Alignment:
| Q |
1 |
tactttggcgcaagttccttctttcaggaccgttgtggtatgcctcactacaagttcccataggctgttggtttttatttccgtctttgtttgtttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35090057 |
tactttggcgcaagttccttctttcaggaccgttgtggtatgcctcactacaagttcccataggctgttggtttttattttcgtctttgtttgtttcttt |
35090156 |
T |
 |
| Q |
101 |
tcgagggttttggtctagtnnnnnnntcatgtatatg---------cnnnnnnnnaataaattttttgagattggcagcaaaggat-gggtttagcggag |
190 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | ||||||||||||||||||| ||||||||||| ||||||||| ||| |
|
|
| T |
35090157 |
tcgagggttttggtctagt-cccccctcatgtatatgttttttttccttttttttaataaattttttgagattgacagcaaaggatggggtttagcagag |
35090255 |
T |
 |
| Q |
191 |
tgtcaacctaattgagatgttgttgcttctcttatgcaactactttctcctggtctagcaaaaagattaaactaataaactaannnnnnnnacctagatt |
290 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35090256 |
tgtcaacttaattgggatgtcgttgcttctcttatgcagctcctttctcctggtctagcaaaaagattaaactaat-------ttttttttacctagatt |
35090348 |
T |
 |
| Q |
291 |
aaatgacagctagtattaaacaattattccacaaaatggatccatatagcgacacaagattaatacacaggttct |
365 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
35090349 |
aaatgacaactagtattatacaattattccacaaaatggatccatatagcgacacaagattactacccaggttct |
35090423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University