View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_35 (Length: 368)
Name: NF1590_high_35
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 69 - 350
Target Start/End: Original strand, 8033151 - 8033432
Alignment:
| Q |
69 |
ctatgtcacagggagtcaatttaatcaataaacaaatctttggggctgttcccaagcacaatattgttgtttttgtccctaaacaagtggctgttcctgt |
168 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8033151 |
ctatgtcacagggagccaatttaattaataaacaaatctttggggctgttcccaagcacaatattgttgtttttgtccctaaacaagtggttgttcctgt |
8033250 |
T |
 |
| Q |
169 |
tgacagcttggttaacaacaatgaatgggtaactctggacaattttgatgaggagaggcccatcaaggaaggaggcaatgtggaggtggctgagatttcc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8033251 |
tgacagcttggttaacaacaatgaatgggtaactctggacaattttgatgaggagaggcccatcaaggaaggaggcaatgtggaggtggctgagatttcc |
8033350 |
T |
 |
| Q |
269 |
gcaatccagaagcgtggtgacgcttcaacattacctctttgcaactattttgcacctcttcatgaggattgtgagcgtcctt |
350 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8033351 |
gcaatccagaagcaaggtgacgcttcaacattacctctttgcaactattttgcacctcttcatgaggattgtgagcgtcctt |
8033432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 233 - 307
Target Start/End: Original strand, 41309030 - 41309104
Alignment:
| Q |
233 |
aaggaaggaggcaatgtggaggtggctgagatttccgcaatccagaagcgtggtgacgcttcaacattacctctt |
307 |
Q |
| |
|
||||||||||| ||| |||| ||| |||||||| | ||||||||||| ||||| || ||||||||||| ||||| |
|
|
| T |
41309030 |
aaggaaggaggtaatatggatgtgcctgagattgcaacaatccagaagagtggtaactcttcaacattatctctt |
41309104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University