View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_38 (Length: 350)
Name: NF1590_high_38
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 15 - 294
Target Start/End: Complemental strand, 25375131 - 25374868
Alignment:
| Q |
15 |
atctttttcagttttagatttcctccaccaacatgtagcaaagtgcattgcaatttgcaacaaacctcacatgattttatcacctttggcttttactcac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25375131 |
atctttttcagttttagatttcctccaccaacatgtagcaaagtgcattgcaatttgcaacaaacctcacatgattttatcaccttt------tactcac |
25375038 |
T |
 |
| Q |
115 |
caattcaacaagaagcataagcattgattcacagaatgaagattctgactcttcctgcattgcttccctggatttagtaagcttctagtcatagtttgta |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25375037 |
caattcaacaaga--------cattgattcacagaatgaagattctgactcttcctgcattccttccctggatttagtaagcttctagtcatagtttgta |
25374946 |
T |
 |
| Q |
215 |
aaacttgctccttcactctaaactgcattatatcaactgnnnnnnnnncttttcagatggcaaatgttagcgagttatgt |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25374945 |
aaacttgct-cttcactctaaactgcattatatcaactg-ttttttttcttttcagatggcaaatgttagcgagttatgt |
25374868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University