View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_44 (Length: 329)
Name: NF1590_high_44
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_44 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 164 - 317
Target Start/End: Complemental strand, 40920149 - 40919996
Alignment:
| Q |
164 |
caacacaaacactcaaaaagaaagttggcacaacggtcccaatagatttagtgcaacaatgatactaaaccaaggtagcagcaaaacaccatagactcga |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40920149 |
caacacaaacactcaaaaagaaagttggcacaacggtcccaatagatttagtgcaacaatgatactaaaccaaggtagcagcaaaacaccatagactcga |
40920050 |
T |
 |
| Q |
264 |
aaaacacaaaccgatgcagcagacgatagaaacatttagtatttaatagaaaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40920049 |
aaaacacaaaccgatgcagcagacgatagaaacatttagtatttaatagaaaca |
40919996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 40920312 - 40920231
Alignment:
| Q |
1 |
cgaaagattaacataggggaaatgtcgctgtgacaatactcttataattttaagaacaataagtttacttgtatccctctag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40920312 |
cgaaagattaacataggggaaatgtcgctgtgacaatactcttataattttaagaacaataagtttacttgtatccctctag |
40920231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 297
Target Start/End: Complemental strand, 2299540 - 2299501
Alignment:
| Q |
258 |
actcgaaaaacacaaaccgatgcagcagacgatagaaaca |
297 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2299540 |
actcgaaaaaaacaaactgatgcagcagacgatagaaaca |
2299501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 248 - 297
Target Start/End: Complemental strand, 38684474 - 38684425
Alignment:
| Q |
248 |
aacaccatagactcgaaaaacacaaaccgatgcagcagacgatagaaaca |
297 |
Q |
| |
|
||||||||||| || ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
38684474 |
aacaccatagaatccaaaaatacaaaccaatgcagcagacgatagaaaca |
38684425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 297
Target Start/End: Complemental strand, 3615 - 3525
Alignment:
| Q |
204 |
aatagatttagtgcaacaatgatactaaaccaaggtagcagcaaaacaccatagactcgaaaaacacaaaccgatgcagcagacgatagaaaca |
297 |
Q |
| |
|
|||||||| |||| || |||| |||||||||||| | ||| ||||||||||| || ||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
3615 |
aatagattcagtgtgaccatgacactaaaccaaggcatcag---aacaccatagaatccaaaaatacaaaccaatgcagcagacgatcgaaaca |
3525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University