View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_48 (Length: 319)
Name: NF1590_high_48
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_48 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 109 - 302
Target Start/End: Complemental strand, 49237 - 49044
Alignment:
| Q |
109 |
ttctaatttattatagcgattaacaatctaaagttacagttctaaggtttggtgctcattctaattctacaaatctcaaaagtgtcgttaagtatctaga |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49237 |
ttctaattgattatagcgattaacaatctaatgttacagttctgaggtttggtgctcatcctaattctacaaatctcaaaagtgtcgttaagtatctaga |
49138 |
T |
 |
| Q |
209 |
taattaatcatgtgatttaaatcgagcaacgatgttaaatcaagttcaattctctagtttctgatcctaactcatttggaatcatatcatttag |
302 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49137 |
taattaatcatgtgagttaaatcgagcaacgatgttaaatcaagttcaattctctagtttctgatcctaactcatttggaatcatatcatttag |
49044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 49300 - 49236
Alignment:
| Q |
23 |
agtaatccttgatattacaatacaaagccacatgtctatcaccgttaaattatgcattgcaagtt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49300 |
agtaatccttgatgttacaatacaaagccacatgtctatcactgttaaattatgcattgcaagtt |
49236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University