View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_56 (Length: 298)
Name: NF1590_high_56
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 284
Target Start/End: Original strand, 15097059 - 15097332
Alignment:
| Q |
11 |
caaaggcacatgaaaaagaactgctataagggagcaatacatcatgggttttgtcactttttgtgaccttaaaaacactctcaaaggttgtaacaaagta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097059 |
caaaggcacatgaaaaagaactgctataagggagcaatacatcataggttttgtcactttttgtgaccttaaaaacactctcaaaggttgtaacaaagta |
15097158 |
T |
 |
| Q |
111 |
tttgtcaaaagatcaggtagtgaatagaaacaatatattgctgccatttcagtgattttaccatcttgtcccatgaaaagcatgattttttccaggttaa |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15097159 |
tttgttaaaagatcaggtagtgaatagaaacaatatattgctgccatttcagtgattttaccatcttgtcccatgaaaagcatgattttttcaaggttaa |
15097258 |
T |
 |
| Q |
211 |
gccaaaggagacttatgggcacaattgccattagaagtatgagaaccatccgttgtagtgaaagggaaagaagt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15097259 |
gccaaaggagacttatgggcacaattgccattagaagtatgagaaccatccgttgtagtgaaagggaaagaagt |
15097332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University