View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_68 (Length: 278)
Name: NF1590_high_68
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 25 - 272
Target Start/End: Complemental strand, 36888902 - 36888659
Alignment:
| Q |
25 |
ggggaaaaactttactttggttatt----ttcaatttgctattatgccttgtaaatcatttttcagttgtcttcttcctttttatgaactattgatttgt |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36888902 |
ggggaaaaactttactttggttattaattttcaatttgctattatgccttgtaaatcatttttcagttgtcttcttcctttttatgaactactgatttgt |
36888803 |
T |
 |
| Q |
121 |
agttatcgttacnnnnnnnnagccttttcactgtgtggctgagagaatcagacaaaaagagataaagagagtgtaagatatagaacgacattattctagt |
220 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36888802 |
agttatcgttacttttttttagctttttcactgtgtggctgagagaatcagacaa--------aaagagagtgtaagttatagaacgacattattctagt |
36888711 |
T |
 |
| Q |
221 |
attcttgtttcttttggacaaaatattattctcgttgttgctattttcttgg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36888710 |
attcttgtttcttttggacaaaatattattctcgttgttgctatttttttgg |
36888659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 250
Target Start/End: Complemental strand, 36875336 - 36875285
Alignment:
| Q |
199 |
tatagaacgacattattctagtattcttgtttcttttggacaaaatattatt |
250 |
Q |
| |
|
||||| || |||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
36875336 |
tataggacaacattattcttgtattcttttttcttttggacaaaacattatt |
36875285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 238 - 267
Target Start/End: Complemental strand, 36888631 - 36888602
Alignment:
| Q |
238 |
acaaaatattattctcgttgttgctatttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36888631 |
acaaaatattattctcgttgttgctatttt |
36888602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University