View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_75 (Length: 268)
Name: NF1590_high_75
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 52 - 252
Target Start/End: Original strand, 27292682 - 27292882
Alignment:
| Q |
52 |
tggtcaaatcataaatatatgttaactgcagtgtataaaaattgaaacgaatattgacatgatgagacctgagtcaagtcaacagatttgaactgcttga |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27292682 |
tggtcaaatcataaatatatgttaactgcagtgtataaaaattgaaacgaatattgacatgatgagacctgagtcaagtcaacggatttgaactgcttga |
27292781 |
T |
 |
| Q |
152 |
acttagacaaaactgggatcaaaccgtggtaaagtctggttcaaggttcaaccggttggtttggttttgaaaacactgatttatagctgtactgaaagca |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27292782 |
acttagacgaaactgggatcaaaccgtggtaaagtctggttcaaggttcaaccggttggtttggttttgaaaacattgatttatagctgtactgaaagca |
27292881 |
T |
 |
| Q |
252 |
t |
252 |
Q |
| |
|
| |
|
|
| T |
27292882 |
t |
27292882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 27292569 - 27292611
Alignment:
| Q |
7 |
acatcatcaatatgtcactaaaaccattcaattctgcattaag |
49 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27292569 |
acatcatcaatatgtcactaaaatcattcaattctgcattaag |
27292611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University