View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_77 (Length: 262)
Name: NF1590_high_77
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 32497040 - 32496792
Alignment:
| Q |
18 |
agctggattctgttggcggttacccagttagtatagtctaacagtcactcacttccaatgagaaccttcatgcatggccgacatcagagttaatttggca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
32497040 |
agctggattctgttggcggttacccagttagtttagcctaacagtcactcacttctaatgagaaccttcaagcatggctgacatcagagttaatttggca |
32496941 |
T |
 |
| Q |
118 |
cagaaaggttcttacgaacgtttcaatctttgtttggagacttctccataacagattactgactaaggataatttggtggctcggggtattcttcctcaa |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496940 |
cagaaaggttcttaccaacgtttcaatctttgcttggagacttctccatgatagattatcaactaaggataatttggtggctcggggtattcttcctcaa |
32496841 |
T |
 |
| Q |
218 |
tctacaa------cgcattgtattttatgatcattttgttcatctcact |
260 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||| |||||| |
|
|
| T |
32496840 |
tctacaacggagccgaattgcattttatgatcattttgttcagctcact |
32496792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University