View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1590_high_88 (Length: 249)

Name: NF1590_high_88
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1590_high_88
NF1590_high_88
[»] chr4 (3 HSPs)
chr4 (178-249)||(50636491-50636562)
chr4 (6-69)||(50636320-50636382)
chr4 (6-63)||(50641420-50641478)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 178 - 249
Target Start/End: Original strand, 50636491 - 50636562
Alignment:
178 gatgttaaggctaagtgcatgtttcttatcacgattaaatcattgaaatcacggtaaaccactttgattaat 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50636491 gatgttaaggctaagtgcatgtttcttatcacgattaaatcattgaaatcacggtaaaccactttgattaat 50636562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 50636320 - 50636382
Alignment:
6 actgaaatgaaaattgtgcaaatgataagtgtttatagattgtgatgagcaataaatagcgtag 69  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
50636320 actgaaatgaaaattgtgcaaatgata-gtgtttatagattgtgatgagcaataaatagcgtag 50636382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 63
Target Start/End: Original strand, 50641420 - 50641478
Alignment:
6 actgaaatgaaaattgtgcaaatgataa-gtgtttatagattgtgatgagcaataaata 63  Q
    |||||||||||||||||||||||||||| ||| ||||| |||||| || | ||||||||    
50641420 actgaaatgaaaattgtgcaaatgataatgtgcttataaattgtgctgtgaaataaata 50641478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University