View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_96 (Length: 241)
Name: NF1590_high_96
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_96 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 43621404 - 43621504
Alignment:
| Q |
1 |
atctttttaaattaattagaatataaaataatggtttgtctgattaaaatgtaaagctatttccagtagcttcaaaaaatgattttaatgagtgaaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43621404 |
atctttttaaattaattagaatataaaataatggtttgtctgattaaaatgtaaagctatttccagtagcttcaaaaaatgattttaatgagtgaaccat |
43621503 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
43621504 |
t |
43621504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 184 - 225
Target Start/End: Original strand, 43621587 - 43621628
Alignment:
| Q |
184 |
attatttttattttaatctcaaatatatttatggtatgaaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43621587 |
attatttttattttaatctcaaatatatttatggtatgaaat |
43621628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University