View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_high_99 (Length: 241)
Name: NF1590_high_99
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_high_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 41735997 - 41735786
Alignment:
| Q |
15 |
tagttagtatatttctagagtgatagttgatttaactataacactagttgaagattgatttttgatacattgatgcaagagcatttcgcaatagattatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735997 |
tagttagtatatttctagagtgatagttgatttaactataacactagttgaagattgatttttgatacattgatgcaagagcatttcgcaatagattatt |
41735898 |
T |
 |
| Q |
115 |
gaagagttaaaagaaaaaacagtagagtaattatgacttacccacaaatgtgattttccctttgaaatgggacttcctcctttagcagcccgtgagctct |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735897 |
gaagagtgaaaagaaaaaacagtagagtaattatgacttacccacaaatgtgattttccctttgaaatgggacttcctcctttagcagcccgtgagctct |
41735798 |
T |
 |
| Q |
215 |
tcaccttattct |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41735797 |
tcaccttattct |
41735786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University