View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_102 (Length: 247)
Name: NF1590_low_102
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_102 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 31696908 - 31697114
Alignment:
| Q |
1 |
acaattctcctctattgtgaatatcaccttgaaagatcaacgtccaccgcaacggaacgtccaacacaaacacagatgtattcctttctagatcttcatc |
100 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
31696908 |
acaattctcctctgtcgtgaatatcaccttgaaagatcaacgtccaccgcaacggaacatccaacaca------gttgtattcctttctagatcttcatc |
31697001 |
T |
 |
| Q |
101 |
aaacacataaaaaagcatggccgataccaattcaacttatactcaaaacgatagtatgtctaattcgtgatcgagccgagatttaaaacattgttttttc |
200 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31697002 |
aaacacttaaaaaagcatggccaataccaattcaacttgtactcaaaacgatagtatgtctaattcgtgatcgagccgagatttaaaacattgttttttc |
31697101 |
T |
 |
| Q |
201 |
tttactaatttta |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31697102 |
tttactaatttta |
31697114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 31698343 - 31698375
Alignment:
| Q |
205 |
ctaattttaacttaaaaattagttagacctttg |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
31698343 |
ctaattttaacttaaaaattagttaaacctttg |
31698375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 19431314 - 19431277
Alignment:
| Q |
32 |
aaagatcaacgtccaccgcaacggaacgtccaacacaa |
69 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
19431314 |
aaagatcaacgtccaccgtaacggaacgtccaatacaa |
19431277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University