View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_106 (Length: 243)
Name: NF1590_low_106
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 11111777 - 11111883
Alignment:
| Q |
1 |
taaaacttttgcaagcatgccttgttaaattttctccttcaatgatgcaagtcattagttataagctttcttatgcatttggataaacttttaaattttc |
100 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
11111777 |
taaaactttcgcaagcatgccttgttgaattttctccttcaacgatgcaagtcattagttataagctttcttatgcatttggataaacttaaaaaatttc |
11111876 |
T |
|
| Q |
101 |
actttgg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
11111877 |
actttgg |
11111883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University