View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_109 (Length: 241)
Name: NF1590_low_109
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_109 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 249669 - 249893
Alignment:
| Q |
18 |
gatatttatcagatatattatgtggaagcaagatcatatgaagttagctagggtaaaagcaaatattatcttcaatttgtaaatgattaaaataattgag |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
249669 |
gatatttatcagatgtattatgtggaagcaagagcatatgaagttagctagggtaaaagcaaatataatcttcaatttgtaaatgatgaaaataattgag |
249768 |
T |
|
| Q |
118 |
agcaagatctaagaaaataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtg-nnnnnnnngaagaaaattaaacaataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
249769 |
agcaagatctaagaaaataaacatgatccatgaaggatatcatactgatctttttgtttgtatgtttctgtgtgtttttttgaagaaaattaaacaataa |
249868 |
T |
|
| Q |
217 |
aattcatctcttttctctttagact |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
249869 |
aattcatctcttttctctttagact |
249893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Original strand, 249994 - 250026
Alignment:
| Q |
206 |
ttaaacaataaaattcatctcttttctctttag |
238 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
249994 |
ttaaacaacaaaattcatctcttttctctttag |
250026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University