View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_112 (Length: 239)
Name: NF1590_low_112
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33036834 - 33037056
Alignment:
| Q |
1 |
tcttaatgagcttgcttgttggacaatcatgaggataattgggtcagatgtattaggttcatggcattgcaaataggaagtatnnnnnnnctcagaagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
33036834 |
tcttaatgagcttgcttgttggacaatcatgaggataattgggtcagatgtattaggttcatggcattgcaaataggaagtataaaaaaactgagaagta |
33036933 |
T |
|
| Q |
101 |
tgagattggagcaaattgatatgatttagaatgtgacaaaatcttttttacttggataacgtgaaaataatgtgttttagaagctaaacttgttttgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33036934 |
tgagattggagcaaattgatatgatttagaatgtgacaaaatcttttttacttggataacgtgaaaataatgtgttttagaagctaaacttgttttgaaa |
33037033 |
T |
|
| Q |
201 |
aattgctaattgaaaattgaaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33037034 |
aattgctaattgaaaattgaaag |
33037056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University