View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_121 (Length: 237)
Name: NF1590_low_121
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_121 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 1048085 - 1048193
Alignment:
| Q |
1 |
ttgttatttgttatatatatagtctactgttaatattggttatttttggttatattctgtcttatctttactcttgccaactagcatgaaatgaccttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048085 |
ttgttatttgttatatatatagtctactgttaatattggttatttttggttatattctgttttatctttactcttgccaactagcatgaaatgaccttat |
1048184 |
T |
|
| Q |
101 |
ttgtgagta |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
1048185 |
ttgtgagta |
1048193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 139 - 222
Target Start/End: Original strand, 1048223 - 1048302
Alignment:
| Q |
139 |
gagggaagaacttgcttcttctatcactttttattgtttaattcttccttcctccatagtatttattgtttactatttcatttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1048223 |
gagggaagaacttgcttcttctatcactttttattgt----ttcttccttcctccatagtatttattgtttaccatttcatttt |
1048302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 1044856 - 1044910
Alignment:
| Q |
30 |
ttaatattggtta-tttttggttatattctgtcttatctttactcttgccaacta |
83 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||||||||| || |||||||||| |
|
|
| T |
1044856 |
ttaatattagttaatttttggttatattttgtcttatctttgcttttgccaacta |
1044910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University