View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1590_low_129 (Length: 229)

Name: NF1590_low_129
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1590_low_129
NF1590_low_129
[»] chr4 (1 HSPs)
chr4 (60-208)||(35089859-35090005)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 60 - 208
Target Start/End: Complemental strand, 35090005 - 35089859
Alignment:
60 ctgttgtgtccaagttaccaaaacctcgagaattccaataaaaaacaattatattgggcaataggagatgactcacccctgcaacgggttctgtacggcg 159  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||    
35090005 ctgttgtgtccaagttaccaaaacctcgggaattccaataaaaaacaattat--tgggcaataggagatgactcacccctgcagcgggttctgtacggcg 35089908  T
160 gcttcccaatccaaagtttctttaatttttgtttatgcttcttagttag 208  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||    
35089907 gcttcccaatccgaagtttctttaatttttgtttatgcttcttagttag 35089859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University