View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_132 (Length: 224)
Name: NF1590_low_132
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_132 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 32782977 - 32782790
Alignment:
| Q |
21 |
agagtttattggaattgctgtatatgcatcaacatgttcggacgaaatattattgaatgacaggcatcaacaatactccgcgttttaaattctttatctt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
32782977 |
agagtttattggaattgctgtatatgcatcaacatgttcggacgaaatattattgaatgacaggcattaacaatactctgcgttttaaattctttatctt |
32782878 |
T |
 |
| Q |
121 |
aattgattccttagattaaaagtggaaccatttgtactaggttttgagcttggagaattcatgtgatggcttacatatgcatataatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32782877 |
aattgattccttagattaaaagtggaaccatttgtactaggttttgagcttggagaattcatgtgatggcttacatatgcatataatg |
32782790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University