View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1590_low_141 (Length: 212)

Name: NF1590_low_141
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1590_low_141
NF1590_low_141
[»] chr7 (1 HSPs)
chr7 (10-193)||(43860771-43860954)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 43860954 - 43860771
Alignment:
10 agtgagatgaatatctatggttgcgtttcaggggtgtgacgcatcggttttgttggagtccactgctggtaacacggcggagaaggatgccattcctaat 109  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43860954 agtgacatgcatatctatggttgcgtttcaggggtgtgacgcatcggttttgttggagtccactgctggtaacacggcggagaaggatgccattcctaat 43860855  T
110 ttatcattagcaggctttgatgtaatagaagacataaaagaagctttggaggaaaaatgtccaggaattgtttcatgtgctgat 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43860854 ttatcattagcaggctttgatgtaatagaagacataaaagaagctttggaggaaaaatgtccaggaattgtttcatgtgctgat 43860771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University