View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_37 (Length: 382)
Name: NF1590_low_37
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 159 - 364
Target Start/End: Complemental strand, 7798723 - 7798518
Alignment:
| Q |
159 |
caccattggtttcttcttctcacagatcacnnnnnnnatagaaatgaaaatcattaatcgctttttattttacagaaaaagaaagagatggagtggcaga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7798723 |
caccattggtttcttcttctcacagatcactttttttatagaaatgaaaatcattaatcgctttttattttacagaaaaagaaagagatggagtggcaga |
7798624 |
T |
|
| Q |
259 |
ggaacggttttaatcagaacgcgaatgttggaatgatgcaagtgaatgtgatgaccaatgaacaagtcgaaactcttcggaaacaaatcgcagcttattc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||| |
|
|
| T |
7798623 |
ggaacggttttaatcagaacgcgaatgttggaatgatgcaagtgaatgtgatgaccaatgaacaagttgaaactcttcggaaacaaatagcagtttattc |
7798524 |
T |
|
| Q |
359 |
tgtaat |
364 |
Q |
| |
|
|||||| |
|
|
| T |
7798523 |
tgtaat |
7798518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 7798894 - 7798764
Alignment:
| Q |
10 |
catcatcaagtaagaactatacaactcttattcatcttcattatgctatgatcattgttaatagagcaaaactacaactcttattcatctttattgagaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7798894 |
catcatcaagtaagaactatacaactcttattcatcttcattatgctatgatcattgttaata--------------------ttcatctttattgagaa |
7798815 |
T |
|
| Q |
110 |
gaatattgatctgatccatgccctagttgttagaaactagaattttgatca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7798814 |
gaatattgatctgatccatgccctagttgttagaaactagaattttgatca |
7798764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University