View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_50 (Length: 330)
Name: NF1590_low_50
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_50 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 330
Target Start/End: Complemental strand, 16560596 - 16560282
Alignment:
| Q |
8 |
cgaagaatatgcacttcattatttcttatatcttaaagagaagacaattgttgcgcagacaagattatttctcgagggatctaaagtaatggttttgttt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16560596 |
cgaaaaatatgcacttcattatttctcatatcttga-gagaagacaattgttgcgcagacaagattatttctcgtgggatctaaagtaatggttttgttt |
16560498 |
T |
 |
| Q |
108 |
ggtggattcaatctcttc--gtgttttagattttgttaaccgaaataggtcggagcttccaggattatcatttatgttgatgtttttcaagggcttgaac |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16560497 |
ggtggattcaatctcttcttgtgttttagattttgttaaccaaaataggtcggagcttccaggattatcatttatgttgatgtttttcaagggcttgaac |
16560398 |
T |
 |
| Q |
206 |
ttctatttactatgcaatatctttttcttcgccaatgttttacccctttaagtattttggttagacgtttaatgagacagatgttattaaagtccttggc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16560397 |
ttctatttactatgcaatatctttttcttcgccaatattttatccctttaag---------tagacgtttaatgagacagatgttattaaagtccttggc |
16560307 |
T |
 |
| Q |
306 |
tgtttactttgggttttggcctagt |
330 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
16560306 |
tgtttactttgggttttggcctagt |
16560282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University