View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_68 (Length: 291)
Name: NF1590_low_68
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 151 - 278
Target Start/End: Original strand, 2442847 - 2442974
Alignment:
| Q |
151 |
tattatagaagatttatgacatagaaaacctaatttatttgactgaagctgctccctacatcgtctaaatgttcttcataacccctgctacattttctat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
2442847 |
tattatagaagatttatgacatagaaaacctaatttatttgactgaagctactccctacatcgtcaaactgttcttcataacccctgctacattttctat |
2442946 |
T |
 |
| Q |
251 |
caaacgttcattgccacaaattacagta |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2442947 |
caaacgttcattgccacaaattacagta |
2442974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University