View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_73 (Length: 283)
Name: NF1590_low_73
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_73 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 51898874 - 51899142
Alignment:
| Q |
18 |
cattgaagaagcactcaatcgccatatcagtttctgtaaagagttcagatcatcatcatccactgttttgaataaaacagaacaccctataattctcatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51898874 |
cattgaagaagcactcaatcgccatatcagtttctgtaaagagttcagatcatcatcatccactgttttgaataaaacagaacaccctatcattctcatg |
51898973 |
T |
 |
| Q |
118 |
agtcgaagaattcgtcggagtttggattgccctagaccgcctcttcgatcaaactcaaccggagttcttcctgctgttgatggtgttcgttcttcttct- |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51898974 |
agtcgaagaattcgtcggagtttggattgccctagaccgcctcttcgatcaaactcaaccggagttcttcctgctgttgatggtgttcgttcttcttctt |
51899073 |
T |
 |
| Q |
217 |
--tcgttgattcgatcagatagttgcttctcatcaatatctggttaagttctttagtttagactctttt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51899074 |
cgtcgttgattcgatcagatagttgcttctcatcaatatctggttaagttctttagtttagactctttt |
51899142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University