View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_74 (Length: 283)
Name: NF1590_low_74
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 6220602 - 6220364
Alignment:
| Q |
11 |
cagagagaaataataagggtaattaataacagttaaaaatggttgtggtacataatgcataatatatcatgtgttaaatgagacaattcactgaaaatac |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6220602 |
cagagagaaataataagggt---taataacagttaaaaatggttgtggtacataatgcata-----tcatgtgttaaatgagacaattcactgaaaatac |
6220511 |
T |
 |
| Q |
111 |
aacttttgccattgacttgtcagcatgtatatggctttattatcctggaactttgccagccctttttctggggtcctcatttgcttcagtccaatatttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220510 |
aacttttgccattgacttgtcagcatgtatatggctttattatcctggaactttgccagccctttttctggggtcctcatttgcttcagtccaatatttc |
6220411 |
T |
 |
| Q |
211 |
tgagagctcgcaaagcacttatcaatgaccaatatgtttggatccac |
257 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220410 |
agagagctagcaaagcacttatcaatgaccaatatgtttggatccac |
6220364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University