View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1590_low_96 (Length: 249)
Name: NF1590_low_96
Description: NF1590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1590_low_96 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 41169974 - 41170206
Alignment:
| Q |
17 |
cattctagtcttaataattatggtagaactacaatactgagggcttcttaaatctgttatttgagttggttctgcctgtccatattggctttactgttac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41169974 |
cattctagtcttaataattatggtagaactacaatactgagggcttcttaaatctgttattcgagttggttctgcctgtccatattggctttactgttac |
41170073 |
T |
 |
| Q |
117 |
gaaaataatgaggggaaggaaaatatggagtttacaccagaagatataaaaatagagttagacaggaagcttgacatttggtagggatagttgggggaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41170074 |
gaaaataatgaggggaaggaaaatatggagtttacaccagaagatataaaaatagagttagacaggaagcttgacatttagtagggatagttgggggaat |
41170173 |
T |
 |
| Q |
217 |
gttgattaatagacagtgcatgagggagacctt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41170174 |
gttgattaatagacagtgcatgagggagacctt |
41170206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University