View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591-INSERTION-6 (Length: 750)
Name: NF1591-INSERTION-6
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591-INSERTION-6 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0209 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0316 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0635 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 396; Significance: 0; HSPs: 30)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 108 - 555
Target Start/End: Complemental strand, 22655607 - 22655161
Alignment:
| Q |
108 |
cttgtttaaaagtgtacatataatttcaaaaacaagctaatgtaaaatcataatttagagggaaaatcattactatctggtatatgatggaagcaacggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22655607 |
cttgtttaaaagtgtacatataatttcaaaaacaagctaatgtaaaatcataatttagagggaaaatcattactatctggtatatgatggaagcaacggt |
22655508 |
T |
 |
| Q |
208 |
aatagtcatgaattttccagcaaaagaatcagaaatgaaggcaccaagcaatggtgtcaagcttgaagttcctccaaagttagtgagagtgttagcagct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22655507 |
aatagtcatgaattttccagcaaaagaatcagaaatgaaggcaccaagcaatggtgtcaagcttgaagttcctccaaagttagtgagagtgttagcagct |
22655408 |
T |
 |
| Q |
308 |
tttgttaatggcatgtgaagctgtgttgttaggtagtttatcatgtttgcattgaaacccaccactgctaacttctcagtaacctcgttagctgcaacaa |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22655407 |
tttgttaatggcatgtgaagctgtgttgttaggtagcttatcatgtttgcattgaaacccaccactgctaacttctcagtaacctcattagctgcaacaa |
22655308 |
T |
 |
| Q |
408 |
cagaaaattaaatcaacattaatatttctatagtttactatctaacccctggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacg |
507 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
22655307 |
cagaaaattaaatcaacattaatatttctttagtttactatctaacccctggttcgattcccaggggaaacaatgtttgatcagtgtgcatgcctctacg |
22655208 |
T |
 |
| Q |
508 |
cataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
22655207 |
cataagtcagattagtcgtccaccttt-gtgggtcgaaaaccagtgcg |
22655161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 132; E-Value: 4e-68
Query Start/End: Original strand, 612 - 747
Target Start/End: Complemental strand, 22655104 - 22654969
Alignment:
| Q |
612 |
gagttagggtttcaaagcataccaaagataaaaggcattgttgcaagccctccttttttccttctagtaagaataccattcttctccatcttttcaaaac |
711 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22655104 |
gagttagggtttcaaagcataccaaagataaaaggcattgttgcaagccctccttttttccttctagtaagattaccattcttctccatcttttcaaaac |
22655005 |
T |
 |
| Q |
712 |
ctgtattcattttgcagtacattaaatgactaatat |
747 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22655004 |
ctgtattcattttgcagtacattaaatgactaatat |
22654969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 42086334 - 42086431
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
42086334 |
ggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcg |
42086431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 9805011 - 9805095
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
9805011 |
ggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtc |
9805095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 23383664 - 23383748
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||| ||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
23383664 |
ggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtc |
23383748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 7308464 - 7308373
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||| ||||||||||||||| || ||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
7308464 |
ggttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacctttgatggatcaaaaacc |
7308373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 460 - 555
Target Start/End: Original strand, 40117424 - 40117519
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||| || |||| ||||||||||| |||||||||||||||||||||| || ||||| ||||||||||||||||| || |||||| ||||| |
|
|
| T |
40117424 |
ttcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcg |
40117519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 5732020 - 5731923
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| || | ||||||||||| ||||||||||||||||||| || || |||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
5732020 |
ggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcg |
5731923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 19572731 - 19572828
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
19572731 |
ggttagattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcg |
19572828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 476 - 554
Target Start/End: Complemental strand, 3653996 - 3653918
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||| |||||||||||| || |||||| |||| |
|
|
| T |
3653996 |
aacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgc |
3653918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 476 - 538
Target Start/End: Original strand, 20255394 - 20255456
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtg |
538 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
20255394 |
aacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtg |
20255456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 1538438 - 1538535
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||| |||| |||| |||||||||| ||||| ||||| |
|
|
| T |
1538438 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcg |
1538535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 8513526 - 8513623
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||| |||||||||||||| || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
8513526 |
ggttcgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcg |
8513623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 25417283 - 25417186
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||| | || |||||||| || ||| ||||||||||| ||||| ||||| |
|
|
| T |
25417283 |
ggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcg |
25417186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 479 - 555
Target Start/End: Complemental strand, 14588696 - 14588620
Alignment:
| Q |
479 |
aacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||| | | |||||| ||||| |
|
|
| T |
14588696 |
aacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcg |
14588620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 477 - 555
Target Start/End: Original strand, 14728109 - 14728187
Alignment:
| Q |
477 |
acaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||| | ||||||||| |||||| ||||| ||||| |
|
|
| T |
14728109 |
acaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcg |
14728187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 12705021 - 12705118
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| || | |||||||||||| ||||| |||||| ||||||||| | ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
12705021 |
ggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcg |
12705118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 535
Target Start/End: Complemental strand, 23247451 - 23247374
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||| ||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
23247451 |
ggttcgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacctttg |
23247374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 535
Target Start/End: Complemental strand, 35813098 - 35813021
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
||||||||||| ||||||| || |||||| ||||||||||| |||||| ||| ||| |||||||||| |||||||| |
|
|
| T |
35813098 |
ggttcgattcctaggggaaataatgcttgaccagtgcgcatgtctctacacatgagtcggattagtcgtccacctttg |
35813021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 510
Target Start/End: Original strand, 28857135 - 28857187
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
28857135 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcat |
28857187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 476 - 547
Target Start/End: Complemental strand, 9168335 - 9168264
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaa |
547 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| || |||||||||| ||||||| ||||||| |||| |
|
|
| T |
9168335 |
aacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaa |
9168264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 472 - 535
Target Start/End: Original strand, 15034096 - 15034159
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||||| || |||||||| || |||||||| |
|
|
| T |
15034096 |
gggaaacaacacttggtcagtgtgcatgcctctacgcatgagcctgattagttgtccacctttg |
15034159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 506
Target Start/End: Original strand, 19839352 - 19839382
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctac |
506 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19839352 |
aacaacgcttgatcagtgcgcatgcctctac |
19839382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 538
Target Start/End: Original strand, 20705588 - 20705650
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtg |
538 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||| ||||| ||||||| | |||||| |
|
|
| T |
20705588 |
aacaacgtttggtcagtgcgcatgcctctacgcataaggcagattaatcgttcatcattggtg |
20705650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 472 - 542
Target Start/End: Complemental strand, 42861304 - 42861234
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| || ||||| |||| |||| |||||||||| |
|
|
| T |
42861304 |
gggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtc |
42861234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 476 - 509
Target Start/End: Original strand, 7336645 - 7336678
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
7336645 |
aacaacgctttatcagtgcgcatgcctctacgca |
7336678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 9812879 - 9812976
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| || | ||||||||||| ||||| |||||| ||||||||| | ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
9812879 |
ggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcg |
9812976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 539
Target Start/End: Original strand, 20525845 - 20525926
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| || | |||||| ||| |||||||||||||||||||||| || |||||||||| |||| ||||||| |
|
|
| T |
20525845 |
ggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgg |
20525926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 539
Target Start/End: Original strand, 30995128 - 30995209
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||| ||||||||||||||||| || ||||||||| ||| ||||||||| |
|
|
| T |
30995128 |
ggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccggattagtcgctcatctttggtgg |
30995209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 38897818 - 38897722
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || |||||| ||||||||| ||||||||||||||||||||| || ||||||| | |||||||||||| || ||||||||||| |
|
|
| T |
38897818 |
ggttcgatttccaggggaa-caacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcg |
38897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 3e-19; HSPs: 37)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 458 - 535
Target Start/End: Complemental strand, 36145315 - 36145238
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||| || |||||||||| |||||||| |
|
|
| T |
36145315 |
ggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacctttg |
36145238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 40780961 - 40780864
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | ||| ||||||||||| ||||||||||||||||||||||| || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
40780961 |
ggttcgattctcaaggggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcg |
40780864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 42722677 - 42722580
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||| |||||| || | ||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
42722677 |
ggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcg |
42722580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 40272431 - 40272347
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||| || ||| ||||||||||| |||||||||||||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
40272431 |
ggttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtc |
40272347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 16450311 - 16450408
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||| ||||||||||||||| || |||||||||| |||||||||| |||| ||||| ||||| |
|
|
| T |
16450311 |
ggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcg |
16450408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 47078469 - 47078566
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||| |||||||||||||| || ||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
47078469 |
ggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcg |
47078566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 55921045 - 55921142
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||| || || ||||| ||| |||||||||||||||| ||||| ||||| |
|
|
| T |
55921045 |
ggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcg |
55921142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 458 - 548
Target Start/End: Complemental strand, 5472948 - 5472858
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaac |
548 |
Q |
| |
|
|||| ||||| | |||||||||||||||| ||||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| |
|
|
| T |
5472948 |
ggtttgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaac |
5472858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 36262865 - 36262770
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||| |||||||||||||| ||| ||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
36262865 |
ggttcgattcccaggg--aacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcg |
36262770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 7246746 - 7246649
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| | || ||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
7246746 |
ggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
7246649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 539
Target Start/End: Original strand, 29895798 - 29895879
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || |||||||||| |||| ||||||| |
|
|
| T |
29895798 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgg |
29895879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 460 - 525
Target Start/End: Complemental strand, 55005404 - 55005339
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcg |
525 |
Q |
| |
|
|||||||| | ||||||||||||||||| || |||||||||||||||||| |||| ||||||||| |
|
|
| T |
55005404 |
ttcgattcgcaggggaaacaacgcttgaccattgcgcatgcctctacgcacaagtcggattagtcg |
55005339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 8889033 - 8889117
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| |||| |||||| |||| ||||||||||| |||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
8889033 |
ggttcgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtc |
8889117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 510
Target Start/End: Original strand, 38075444 - 38075496
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38075444 |
ggttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcat |
38075496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 52950093 - 52950177
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||| |||||| ||| | |||||||||| ||||||||||||||| |
|
|
| T |
52950093 |
ggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtc |
52950177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 1940874 - 1940780
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||| || ||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
1940874 |
ggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcg |
1940780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 555
Target Start/End: Original strand, 2559336 - 2559415
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| ||||| |||| ||||||||||||||| ||||| ||||| |
|
|
| T |
2559336 |
aacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcg |
2559415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 476 - 542
Target Start/End: Original strand, 53354561 - 53354627
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||||| | ||||||||||||| ||||| |||||| |
|
|
| T |
53354561 |
aacaacacttaaccagtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtc |
53354627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 531
Target Start/End: Original strand, 1446837 - 1446910
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacc |
531 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || |||||||||| |||| |
|
|
| T |
1446837 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc |
1446910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 20128320 - 20128417
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| ||||| ||||| |||||||||||||| |||||| || |||||||||| |||| ||||||||||| ||||| ||||| |
|
|
| T |
20128320 |
ggttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcg |
20128417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 460 - 525
Target Start/End: Original strand, 35359749 - 35359814
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcg |
525 |
Q |
| |
|
|||||||| | |||| ||||||| |||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35359749 |
ttcgattctcagggggaacaacgtttgaccagtgcgcatgcctcaacgcataagttggattagtcg |
35359814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 38166038 - 38166135
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||| ||||||||||| ||||||||||| ||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
38166038 |
ggttggattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
38166135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 539
Target Start/End: Original strand, 53599071 - 53599152
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| || | ||||||| ||| |||||||||||||||||||||| || ||||| |||||||||||| |||| |
|
|
| T |
53599071 |
ggttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagtgg |
53599152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 3159569 - 3159485
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||| | || |||| ||||||||||| ||||||||||||||||||||| || ||||||||| ||||| |||||||||| |
|
|
| T |
3159569 |
ggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtc |
3159485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 538
Target Start/End: Original strand, 6779222 - 6779302
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtg |
538 |
Q |
| |
|
|||||||||||| |||| |||||| | || ||||||||||||||||| |||| || |||||||||| ||||||||||| |
|
|
| T |
6779222 |
ggttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccggattagtcgtccacctttggtg |
6779302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 26237522 - 26237438
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | |||||||||||| |||||||||||| ||| || ||||||| ||| ||||||| || |||| ||| |||||| |
|
|
| T |
26237522 |
ggttcgattctcaggggaaacaacgtttgatcagtgcgtatgtctttacgcatgagtcggattagtagtccaccattgatgggtc |
26237438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 10541027 - 10541078
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10541027 |
ggttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgca |
10541078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 476 - 555
Target Start/End: Original strand, 16645147 - 16645226
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| ||||| |||||||||||| ||| ||| |||||||||| ||||| ||||||||| ||||| ||||| |
|
|
| T |
16645147 |
aacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcg |
16645226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 476 - 555
Target Start/End: Original strand, 17080072 - 17080151
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || ||||||||| |||||||| ||| || |||||| ||||| |
|
|
| T |
17080072 |
aacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcg |
17080151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 24166461 - 24166512
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24166461 |
ggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgca |
24166512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 29588747 - 29588798
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29588747 |
ggttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgca |
29588798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 456 - 510
Target Start/End: Original strand, 20421782 - 20421836
Alignment:
| Q |
456 |
ctggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
||||||||||| || |||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
20421782 |
ctggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcat |
20421836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 489 - 555
Target Start/End: Original strand, 21429343 - 21429409
Alignment:
| Q |
489 |
cagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
21429343 |
cagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcg |
21429409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 542
Target Start/End: Complemental strand, 49260747 - 49260681
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
49260747 |
aacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtc |
49260681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 4738629 - 4738726
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || || | |||||||||| ||||||||||| |||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
4738629 |
ggttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcg |
4738726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 531
Target Start/End: Complemental strand, 8064898 - 8064825
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacc |
531 |
Q |
| |
|
|||||||||||| ||| || ||| ||||| |||||||||||||||||||||| || |||||||||| |||| |
|
|
| T |
8064898 |
ggttcgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacc |
8064825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 476 - 541
Target Start/End: Original strand, 38168286 - 38168350
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
38168286 |
aacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagtgggt |
38168350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 5e-18; HSPs: 29)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 458 - 553
Target Start/End: Complemental strand, 36619354 - 36619259
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtg |
553 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||| |||||||||||||||| || |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36619354 |
ggttcgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcaaaaaccagtg |
36619259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 38578967 - 38578870
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
38578967 |
ggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
38578870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 39474949 - 39475046
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||||||||| ||||||||||| || |||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
39474949 |
ggttcgattcctatggggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcg |
39475046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 43862072 - 43861975
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||| ||| |||||||||||||||||||||| || |||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
43862072 |
ggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcg |
43861975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 476 - 552
Target Start/End: Complemental strand, 45697272 - 45697196
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagt |
552 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| | |||||||| ||||||||||||||| |||||||| |
|
|
| T |
45697272 |
aacaacacttgatcagtgcgcatgcctctacgcatgagttgggttagtcgtccacctttggtgggtcggaaaccagt |
45697196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 539
Target Start/End: Complemental strand, 26423387 - 26423306
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| | |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
26423387 |
ggttcgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggtgg |
26423306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 13095867 - 13095951
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||| |||||| |||| |||||| |||| |||||||||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
13095867 |
ggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtc |
13095951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 22973976 - 22974067
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||| | |||| ||||||||||| ||||| |||||| ||||||||| || |||||||||| |||||||||||||||| ||||| |
|
|
| T |
22973976 |
ggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggtgggtcagaaacc |
22974067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 43925521 - 43925612
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||||||||||||||||||||| || ||||||| ||| ||||||| ||| ||| ||||| |
|
|
| T |
43925521 |
ggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacctttgatggatcagaaacc |
43925612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 459 - 542
Target Start/End: Original strand, 47341886 - 47341969
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| |||| |||||| |||| ||||||||||||||||||||| || | |||| |||||||||| |||||||||| |
|
|
| T |
47341886 |
gttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtc |
47341969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 10047976 - 10047879
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||||||| |||||||||||| || | ||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
10047976 |
ggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccaccattggtgggtcggaaaccggtgcg |
10047879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 539
Target Start/End: Complemental strand, 10317845 - 10317765
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||| || ||| |||| |||||||| ||||||||| ||||||| | ||||||||| ||||||||||||| |
|
|
| T |
10317845 |
ggttcgattcccagggggaataacacttggtcagtgcgtatgcctctatgcataagca-gattagtcgctcacctttggtgg |
10317765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 18785678 - 18785775
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||| |||||| |||| |||||||||||||||||||||| | |||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
18785678 |
ggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcg |
18785775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 27028288 - 27028385
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || |||| |||||| |||| |||||||||||||||||| ||| || ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
27028288 |
ggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcg |
27028385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 48804692 - 48804789
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||| |||||| |||| |||||||||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
48804692 |
ggttcgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcg |
48804789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 17748482 - 17748398
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||| | || |||||||||| |||||||| |||||| |
|
|
| T |
17748482 |
ggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtc |
17748398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 463 - 535
Target Start/End: Complemental strand, 45960098 - 45960026
Alignment:
| Q |
463 |
gattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
||||||| ||| |||||| |||| |||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
45960098 |
gattcccaagggcaacaacacttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttg |
45960026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 1797469 - 1797520
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1797469 |
ggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgca |
1797520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 460 - 555
Target Start/End: Complemental strand, 27875186 - 27875091
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| |||| || ||| |||| |||||| ||||||||||||||| ||| ||||||||| ||||||| ||||||| |||||| ||||| |
|
|
| T |
27875186 |
ttcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcg |
27875091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 479 - 542
Target Start/End: Complemental strand, 41268003 - 41267940
Alignment:
| Q |
479 |
aacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
41268003 |
aacgcttgattagtgtgcatgcctctacgcatgagttagattagtcgtccacctttgatgggtc |
41267940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 48224813 - 48224734
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || ||| ||||||| |||| |||||||||||| ||||||| |||| |
|
|
| T |
48224813 |
aacaacgcttgatcagtgcgcatgtatctacgtatgagtcaaattagtccttcatctttggtgggtcgaaaaccaatgcg |
48224734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 48244438 - 48244359
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| || ||||||||| ||||||||||||| || |||||| ||||| |
|
|
| T |
48244438 |
aacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgcg |
48244359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 523
Target Start/End: Original strand, 365149 - 365214
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagt |
523 |
Q |
| |
|
|||||||||| | || | |||||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
365149 |
ggttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctctacgcatgagcctgattagt |
365214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 34659235 - 34659332
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | ||| |||||||||||| ||||||||||||||||||||| || ||||||||| |||| |||||| ||| |||||| ||||| |
|
|
| T |
34659235 |
ggttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcg |
34659332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 459 - 554
Target Start/End: Complemental strand, 5039517 - 5039422
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||||| || | |||||| |||| ||||||| ||| ||||||||||| || ||||||||| ||||||||||||| || |||||| |||| |
|
|
| T |
5039517 |
gttcgattcctaggaggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgc |
5039422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 459 - 554
Target Start/End: Original strand, 23658189 - 23658284
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||| || |||| ||||||||||| ||||| |||||||||||| || || |||||||||| || ||||||||||||| ||||| |||| |
|
|
| T |
23658189 |
gttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggtgggtcagaaacctgtgc |
23658284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 8734786 - 8734689
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| | ||||| ||||| ||||| ||||||||||||||| ||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
8734786 |
ggttcgatttcttgggggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcg |
8734689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 14650326 - 14650423
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || || | ||||| |||||| |||||| |||||||||||||| || | ||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
14650326 |
ggttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccggtgcg |
14650423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 471 - 555
Target Start/End: Original strand, 23060701 - 23060783
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||| || || |||||||| |||||| ||| ||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
23060701 |
gggggaacaacgtttgaccaatgtgcatgcct--acgcatgagtcggattagtcgttcacctttggtggataaaaaaccggtgcg |
23060783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 6864 - 6961
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
6864 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcg |
6961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 460 - 553
Target Start/End: Original strand, 9856 - 9949
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtg |
553 |
Q |
| |
|
||||||| || |||| ||||||||||| ||||||||||||||||||||| || |||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
9856 |
ttcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcagaaaccagtg |
9949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 8e-17; HSPs: 19)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 45521179 - 45521275
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||||||||||||||||||| || ||||||||| ||||||||| |||||| ||||| ||||| |
|
|
| T |
45521179 |
ggttcgattcccaggggaa-caacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcg |
45521275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 554
Target Start/End: Original strand, 18374020 - 18374116
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||||| | ||| |||||||||||| |||||||||||||||||||||| || |||||||||| || |||||||||||| |||||| |||| |
|
|
| T |
18374020 |
ggttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgc |
18374116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 460 - 555
Target Start/End: Complemental strand, 4479393 - 4479299
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| |||||| ||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
4479393 |
ttcgattcccaggggaa-caacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcg |
4479299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 6100482 - 6100573
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| || | ||||||||||| ||||||||||||| |||||||| || |||||||||||||||||| ||||||| |||||| |
|
|
| T |
6100482 |
ggttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagtgggtcgaaaacc |
6100573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 8141112 - 8141203
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||||||||||||||||| || ||||||||| ||| |||||||||||| ||||| |
|
|
| T |
8141112 |
ggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaacc |
8141203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 14666171 - 14666074
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||||||||||||| ||| ||||||||| ||| |||||||||| |||||| ||||| |
|
|
| T |
14666171 |
ggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggtgggtcgaaaaccggtgcg |
14666074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 10927616 - 10927700
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| || | ||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
10927616 |
ggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtc |
10927700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 460 - 555
Target Start/End: Original strand, 43032913 - 43033008
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
43032913 |
ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcg |
43033008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 14846586 - 14846669
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | |||||| ||| | ||| ||||||||||||||||||||||| ||| ||| |||||| ||||||||||||||| |
|
|
| T |
14846586 |
ggttcgattctcaggggaa-caatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttggtgggtc |
14846669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 535
Target Start/End: Original strand, 583840 - 583899
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
583840 |
aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttg |
583899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 3418595 - 3418516
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||| ||| |||||||||| ||||||| |||||||| ||||| ||||| |
|
|
| T |
3418595 |
aacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcg |
3418516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 471 - 548
Target Start/End: Original strand, 2209806 - 2209883
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaac |
548 |
Q |
| |
|
||||||||||| ||| |||||||||||| | |||||||||||| ||||||||| ||||| ||||| ||||| |||| |
|
|
| T |
2209806 |
ggggaaacaacatttggtcagtgcgcatgtccctacgcataagttggattagtcgctcaccattggtaggtcagaaac |
2209883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 546
Target Start/End: Complemental strand, 33401899 - 33401811
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaa |
546 |
Q |
| |
|
||||||||| | |||| |||||| ||||| ||||| |||||||||||||||| ||| ||||||||| ||||||| |||| |||||| |
|
|
| T |
33401899 |
ggttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgcccacctttagtggatcaaaa |
33401811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 460 - 552
Target Start/End: Complemental strand, 34710665 - 34710573
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagt |
552 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||| ||| || |||| || ||||||| || | |||||||||| ||||||||| |
|
|
| T |
34710665 |
ttcgattcccaggggaaacaacacttggctagtgcgcatgcctttacacacaagtcggactagtcgtccatcattggtgggtcgaaaaccagt |
34710573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 1013077 - 1012986
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||| | ||||||||||||||| || |||| |||||||||||| |||| || |||||| |
|
|
| T |
1013077 |
ggttcgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcacctttagtggatcgaaaacc |
1012986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 17981451 - 17981502
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||| |||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
17981451 |
ggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgca |
17981502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 539
Target Start/End: Complemental strand, 9860095 - 9860014
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||| |||||||||||| ||| || |||||||||| |||| ||||||| |
|
|
| T |
9860095 |
ggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagccagattagtcgtccaccattggtgg |
9860014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 15884655 - 15884559
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||||| |||| |||| |||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
15884655 |
ggttcgattcccaggggaa-caacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
15884559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 499
Target Start/End: Original strand, 22810090 - 22810130
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatg |
499 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
22810090 |
ggttcgattccctggggaa-caacgcttggtcagtgcgcatg |
22810130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 8e-17; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 21898658 - 21898755
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| || | ||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
21898658 |
ggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcg |
21898755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 459 - 542
Target Start/End: Original strand, 11142614 - 11142697
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||| | | |||||||||| |||| |||||||||||||||||||||| ||| ||||||| || || |||||||||||| |
|
|
| T |
11142614 |
gttcgattcgcagtggaaacaacgtttgaccagtgcgcatgcctctacgcatgagtcagattagttgtccaactttggtgggtc |
11142697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 5253323 - 5253226
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||| ||| ||||||||||||||| ||||| ||||| |
|
|
| T |
5253323 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcg |
5253226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 472 - 550
Target Start/End: Original strand, 8888906 - 8888984
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacca |
550 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||| ||| |||||||||| |||||||| ||| || ||||||| |
|
|
| T |
8888906 |
gggaaacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatggatcgaaaacca |
8888984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 8612074 - 8611977
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| || | |||||||||||| ||||| |||||| ||||||||| | ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
8612074 |
ggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcg |
8611977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 539
Target Start/End: Complemental strand, 9179836 - 9179755
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| |||| |||||| ||||| |||| |||| ||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
9179836 |
ggttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacctttggtgg |
9179755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 12635824 - 12635921
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||||||||||||||| ||| ||||||||| ||| |||||||||| ||||| ||||| |
|
|
| T |
12635824 |
ggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcg |
12635921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 29444865 - 29444768
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| | |||| ||||||||||| |||||||||||||||||||||| || ||||||| || || |||||||||||| |||| |||||| |
|
|
| T |
29444865 |
ggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggtgggtcggaaactagtgcg |
29444768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 5029827 - 5029911
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | ||| ||||||| ||| ||||||||||||||||||||||| ||| ||||||||| || ||||| |||||| |
|
|
| T |
5029827 |
ggttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtc |
5029911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 526
Target Start/End: Original strand, 9147311 - 9147379
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgt |
526 |
Q |
| |
|
|||||||||||| |||| ||| || ||||| |||||| |||||||||||||||||| |||||||||| |
|
|
| T |
9147311 |
ggttcgattcccagggggaacgacacttgaccagtgcacatgcctctacgcataagccggattagtcgt |
9147379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 476 - 548
Target Start/End: Complemental strand, 10311551 - 10311479
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaac |
548 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||| ||||||||| ||||| |||||||||| ||||| |
|
|
| T |
10311551 |
aacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtcgaaaac |
10311479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 510
Target Start/End: Complemental strand, 14107458 - 14107406
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
|||||||||||| || | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
14107458 |
ggttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcat |
14107406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 460 - 555
Target Start/End: Original strand, 3601096 - 3601191
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||| | |||| ||||||||||| |||||||||||||| ||| || || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
3601096 |
ttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcg |
3601191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 9633707 - 9633628
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
9633707 |
aacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
9633628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 554
Target Start/End: Complemental strand, 2271385 - 2271307
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| || |||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
2271385 |
aacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaaccagtgc |
2271307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 457 - 555
Target Start/End: Original strand, 8938720 - 8938818
Alignment:
| Q |
457 |
tggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||||| || | |||||| ||||| ||||||||| || ||||||||| || ||||||||| |||||||| |||||| ||||| ||||| |
|
|
| T |
8938720 |
tggttcgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcg |
8938818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 6606197 - 6606100
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| |||||| |||| ||||| ||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
6606197 |
ggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcg |
6606100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 13036104 - 13036007
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| | |||| |||||| |||| |||||||||||||||||||||| || |||||||||| ||| |||||||||| ||||| ||||| |
|
|
| T |
13036104 |
ggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcg |
13036007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 19089508 - 19089605
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||| |||||| |||| ||||| ||||||||||||||| || |||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
19089508 |
ggtttgattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcg |
19089605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 34954719 - 34954622
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| ||||||| ||| |||||| ||| ||||||||||| || |||||||||| |||||||| |||||| |||||| |||| |
|
|
| T |
34954719 |
ggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacctttgatgggtcggaaaccaatgcg |
34954622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 8e-17; HSPs: 29)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 41663957 - 41663860
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||||||||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
41663957 |
ggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcg |
41663860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 49078121 - 49078218
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||||||||||| |||| |||||||||||||||||||||| || ||||||||||||||| ||||| |||| ||||| ||||| |
|
|
| T |
49078121 |
ggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcg |
49078218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 5855529 - 5855613
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| || | ||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
5855529 |
ggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtc |
5855613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 15465972 - 15466056
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||| || |||| ||||||||||| ||||||| |||||||||||||| ||| ||||| |||| |||||||||||||||| |
|
|
| T |
15465972 |
ggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtc |
15466056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 26325819 - 26325916
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| | || |||||| |||| ||||||||||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
26325819 |
ggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcg |
26325916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 45361983 - 45361886
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | || | ||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
45361983 |
ggttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcg |
45361886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 5504038 - 5504122
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | ||| |||||||||||||| ||||| ||||||||||||||| || |||||||||| |||||||| |||||| |
|
|
| T |
5504038 |
ggttcgattctcagggaaaacaacgcttgattagtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtc |
5504122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 17642105 - 17642021
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
17642105 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtc |
17642021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 510
Target Start/End: Complemental strand, 28324681 - 28324629
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28324681 |
ggttcgattccccggggaaacaacacttggtcagtgcgcatgcctctacgcat |
28324629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 34719783 - 34719867
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| || || ||||||||| ||||||||||||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
34719783 |
ggttcgattcccactgggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtc |
34719867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 471 - 555
Target Start/End: Original strand, 16956486 - 16956570
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||| || |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
16956486 |
ggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcacctttggtgggtcggaaaccagtgcg |
16956570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 541
Target Start/End: Complemental strand, 9659279 - 9659197
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||||||||||| |||||| ||||| |||| ||||||||||||| ||||||| || |||||||||| |||||||||||||| |
|
|
| T |
9659279 |
ggttcgattcccaggggaa-caacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttggtgggt |
9659197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 10336523 - 10336614
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||||||| | |||| |||||||||||| |||||||||||||||||||||| || ||||| |||| |||||||| ||| || |||||| |
|
|
| T |
10336523 |
ggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatcgtccacctttgatggatcgaaaacc |
10336614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 509
Target Start/End: Complemental strand, 50503462 - 50503411
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||| |||||| ||||| ||||||||||||||||||||| |
|
|
| T |
50503462 |
ggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgca |
50503411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 8763998 - 8764095
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||| ||||| |||| |||||| |||| ||||||||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
8763998 |
ggttcgtttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcg |
8764095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 11397989 - 11397906
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| |||||| ||||| ||| || |||| |||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
11397989 |
ggttcgattccgaggggaa-caacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacctttggtgggtc |
11397906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 554
Target Start/End: Complemental strand, 30927828 - 30927732
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
||||||||| || | || ||||||||||| || || |||||||||||||||| || |||||||||| ||| |||||||||||| ||||| |||| |
|
|
| T |
30927828 |
ggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgc |
30927732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 510
Target Start/End: Complemental strand, 48798171 - 48798119
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
||||||||| || |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
48798171 |
ggttcgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcat |
48798119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 513
Target Start/End: Original strand, 16263552 - 16263607
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataag |
513 |
Q |
| |
|
||||||||| || || | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16263552 |
ggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataag |
16263607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 17358572 - 17358481
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||| | ||| |||||||||||| || ||||||||||| ||||||| || ||||||| ||||| |||| |||||||| ||||| |
|
|
| T |
17358572 |
ggttcgattctcagggagaacaacgcttgaccaatgcgcatgcctttacgcatgagcccgattagttgttcatctttagtgggtcagaaacc |
17358481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 541
Target Start/End: Original strand, 18915874 - 18915957
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||| ||||||||||||||| || ||||||||| ||||| ||||||||| |
|
|
| T |
18915874 |
ggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggtgggt |
18915957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 21849305 - 21849215
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||||||||||||||| || ||||||||| |||| |||||||||| |||||| |
|
|
| T |
21849305 |
ggttcgattcccaggggaa-caacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaacc |
21849215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 32151023 - 32150932
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||||||| || |||| |||||| ||| ||||||||||||||| ||||||| || |||||||| ||||||||| |||||| |||||| |
|
|
| T |
32151023 |
ggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaacc |
32150932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Complemental strand, 43959922 - 43959871
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||| |||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43959922 |
ggttcaattcccagggggaacaacgcttggccagtgcgcatgcctctacgca |
43959871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 476 - 537
Target Start/End: Original strand, 10422813 - 10422874
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggt |
537 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
10422813 |
aacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggt |
10422874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 507
Target Start/End: Complemental strand, 18649453 - 18649404
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacg |
507 |
Q |
| |
|
||||||||| | |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
18649453 |
ggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacg |
18649404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 26660145 - 26660241
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || ||| |||||| ||||||||| ||||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
26660145 |
ggttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggtgggtcggaaaccggtgcg |
26660241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 460 - 509
Target Start/End: Complemental strand, 33004114 - 33004065
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||| || |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
33004114 |
ttcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgca |
33004065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 478 - 535
Target Start/End: Complemental strand, 33498920 - 33498863
Alignment:
| Q |
478 |
caacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
33498920 |
caacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttg |
33498863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 8801 - 8717
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||| ||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
8801 |
ggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtc |
8717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 3e-16; HSPs: 40)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 50405704 - 50405620
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||| ||||||||| |||| |||||||||| |
|
|
| T |
50405704 |
ggttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtc |
50405620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 472 - 555
Target Start/End: Complemental strand, 35998658 - 35998575
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||| ||||| |||| ||||||| |||||||| ||||| ||||| |
|
|
| T |
35998658 |
gggaaacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcg |
35998575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 472 - 542
Target Start/End: Complemental strand, 24506735 - 24506665
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| ||| ||||||||| ||||| |||||||||| |
|
|
| T |
24506735 |
gggaaacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtc |
24506665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 30045827 - 30045924
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||| ||||||||||| ||||||||||| ||||||||| ||| ||||||||||| |||||||| |||||| |||| |||||| |
|
|
| T |
30045827 |
ggttcgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaaactagtgcg |
30045924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 472 - 549
Target Start/End: Complemental strand, 43330819 - 43330742
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
43330819 |
gggaaacaacacttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaacc |
43330742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 47219150 - 47219247
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||| || |||||||||| |||||||| |||||| ||||| ||||| |
|
|
| T |
47219150 |
ggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtgcg |
47219247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 54261232 - 54261329
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| || | ||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
54261232 |
ggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcg |
54261329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 26043818 - 26043909
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| ||| |||||| |||| |||||||||||||||||||||| || ||||||||| |||||||||||| |||| ||||| |
|
|
| T |
26043818 |
ggttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaacc |
26043909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 7328850 - 7328946
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||| ||||||| || ||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
7328850 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcg |
7328946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 478 - 555
Target Start/End: Original strand, 23511593 - 23511670
Alignment:
| Q |
478 |
caacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| ||| ||||| |||| |||||||| |||||| |||||| ||||| |
|
|
| T |
23511593 |
caacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcg |
23511670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 28572312 - 28572215
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| ||||||||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
28572312 |
ggttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
28572215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 45877460 - 45877557
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || ||||||||||| |||| |||||| ||||||||||||||| || ||||||||||||||| ||| |||||| ||||| ||||| |
|
|
| T |
45877460 |
ggttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcg |
45877557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 51060382 - 51060285
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| |||||| |||| ||||||||||||||||||||||| | |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
51060382 |
ggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcg |
51060285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 29127925 - 29128009
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||| || ||| |||||| |||| ||||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
29127925 |
ggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtc |
29128009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 35315962 - 35316046
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||||||||||||| || ||||||||| ||| ||||||||||| |
|
|
| T |
35315962 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtc |
35316046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 3136777 - 3136698
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| ||| |||||||||| |||||||||| |||| ||||| ||||| |
|
|
| T |
3136777 |
aacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcg |
3136698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 4638160 - 4638211
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
4638160 |
ggttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgca |
4638211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 541
Target Start/End: Original strand, 25294966 - 25295049
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||| ||||| ||||||||||||| |||| ||||||||||||||||| |||| || |||||||||| |||| ||||||||| |
|
|
| T |
25294966 |
ggtttgattctctggggaaacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccaccattggtgggt |
25295049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 471 - 542
Target Start/End: Complemental strand, 34374530 - 34374459
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||||||| ||||||||| | |||||||||||| |
|
|
| T |
34374530 |
ggggaaacaacacttggtcagtgcgcatgcctcaacgcataagtcggattagtcgcccttctttggtgggtc |
34374459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 535
Target Start/End: Complemental strand, 45450530 - 45450471
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45450530 |
aacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttg |
45450471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 49198357 - 49198448
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||||||||| |||| |||||| |||| |||||||||||||||||||||| || |||||||||| |||| ||||||| ||| ||||| |
|
|
| T |
49198357 |
ggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcagaaacc |
49198448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 459 - 509
Target Start/End: Complemental strand, 15795593 - 15795544
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
15795593 |
gttcgattcccaggggaa-caacgcttggtcagtgcgcatgcctctacgca |
15795544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 458 - 504
Target Start/End: Complemental strand, 51683055 - 51683009
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctct |
504 |
Q |
| |
|
|||||||||||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
51683055 |
ggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctct |
51683009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 535
Target Start/End: Complemental strand, 15285802 - 15285757
Alignment:
| Q |
490 |
agtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
15285802 |
agtgcgcatgcctctacacataagttggattagtcgttcacctttg |
15285757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 460 - 541
Target Start/End: Original strand, 29135921 - 29136002
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||||||||| |||| |||||| |||| |||||||||||||||||||||| || |||||||| | |||| ||||||||| |
|
|
| T |
29135921 |
ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccaccattggtgggt |
29136002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 33251668 - 33251765
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| | || ||||||| ||| ||||| |||||||||||||||| || |||||||||| ||| |||| |||||| ||||| |||||| |
|
|
| T |
33251668 |
ggttcgattcccggtgggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgtccacatttgatgggtcgaaaacgagtgcg |
33251765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 459 - 543
Target Start/End: Original strand, 40944890 - 40944973
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtca |
543 |
Q |
| |
|
||||||||||| |||| |||||| ||| | |||| |||||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
40944890 |
gttcgattcccagggggaacaacacttaaccagtatgcatgcctctacgcatgag-cggattagtcgctcacctttggtgggtca |
40944973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 476 - 555
Target Start/End: Complemental strand, 3507616 - 3507537
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| || ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
3507616 |
aacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcg |
3507537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 31072884 - 31072935
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||||| || |||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
31072884 |
ggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgca |
31072935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 45402419 - 45402368
Alignment:
| Q |
491 |
gtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
45402419 |
gtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtc |
45402368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 488 - 554
Target Start/End: Complemental strand, 40660398 - 40660332
Alignment:
| Q |
488 |
tcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
||||||||||||||||||||||| | ||||| || ||||||||||||||||| |||||| |||| |
|
|
| T |
40660398 |
tcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcgaaaaccggtgc |
40660332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 489 - 555
Target Start/End: Complemental strand, 49021273 - 49021207
Alignment:
| Q |
489 |
cagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
49021273 |
cagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcg |
49021207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 459 - 509
Target Start/End: Complemental strand, 52364900 - 52364850
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||||||| | | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
52364900 |
gttcgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgca |
52364850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 474 - 555
Target Start/End: Complemental strand, 2029352 - 2029271
Alignment:
| Q |
474 |
gaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||||||| || ||||||||| |||| ||| |||||| ||||||||||| |
|
|
| T |
2029352 |
gaaacaacgcttggttagtacgcatgcctctacgcatgagctggattagtcgcccaccattgatgggtcgcaaaccagtgcg |
2029271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 460 - 537
Target Start/End: Original strand, 3755578 - 3755655
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggt |
537 |
Q |
| |
|
|||||||||| || | ||||||| |||| ||||||||||| |||||||||| || |||||||||| ||||||||| |
|
|
| T |
3755578 |
ttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctacctttggt |
3755655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 13893932 - 13894029
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| |||| || |||| ||||||||||| ||| ||||||||||||||| || || ||||||||| |||||||||||| || |||||| ||||| |
|
|
| T |
13893932 |
ggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcg |
13894029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 462 - 555
Target Start/End: Complemental strand, 29762252 - 29762159
Alignment:
| Q |
462 |
cgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||| | |||| |||||| |||| ||||||||||||||||| |||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
29762252 |
cgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcg |
29762159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 30767348 - 30767251
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || |||| |||||| |||| ||||| ||||||||||||||| || ||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
30767348 |
ggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaactagtgcg |
30767251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 472 - 521
Target Start/End: Complemental strand, 41223125 - 41223076
Alignment:
| Q |
472 |
gggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgatta |
521 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
41223125 |
gggaaacaacgtttggccaatgcgcatgcctctacgcataagtctgatta |
41223076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 531
Target Start/End: Complemental strand, 42412875 - 42412802
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacc |
531 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||| ||||||||||||||| || ||||||||| ||||| |
|
|
| T |
42412875 |
ggttcgattcccggggggaacaacgcttggcaagtgcccatgcctctacgcatgagccggattagtcgctcacc |
42412802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 579 - 676
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| |||||| ||||||||||| ||||||||||||| || || ||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
579 |
ggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcg |
676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 471 - 540
Target Start/End: Original strand, 319444 - 319513
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtggg |
540 |
Q |
| |
|
|||| ||||||||||| |||||||||| |||||| |||| || |||||||||| ||||||||||||| |
|
|
| T |
319444 |
gggggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggtggg |
319513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 38)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 535
Target Start/End: Complemental strand, 15234161 - 15234084
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||| | |||| |||||| ||||| ||||||||||||||||||||| |||| ||||||||||||| ||||| |
|
|
| T |
15234161 |
ggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagattagtcgttcatctttg |
15234084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 25540504 - 25540407
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||| ||||||||||| ||||||||||||||||||||| || |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
25540504 |
ggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcg |
25540407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 41220641 - 41220738
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| || | ||||||||||| |||||||||||||||||||||| || ||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
41220641 |
ggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcg |
41220738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 21286450 - 21286501
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21286450 |
ggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgca |
21286501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 459 - 542
Target Start/End: Original strand, 22593142 - 22593224
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
||||||||||| |||| ||||||| ||| |||||||||||||||||||||| || |||||||||| ||||||||||||||| |
|
|
| T |
22593142 |
gttcgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtc |
22593224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 460 - 549
Target Start/End: Complemental strand, 6358249 - 6358160
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||||| || |||| |||||| |||| |||||||||||||||||||||| || |||||||||| |||| |||||||||| |||||| |
|
|
| T |
6358249 |
ttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcgaaaacc |
6358160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 12455316 - 12455413
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||||||||||||||||||| || ||||||||| ||||| |||||||||| ||||| ||||| |
|
|
| T |
12455316 |
ggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcg |
12455413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 534
Target Start/End: Complemental strand, 2528441 - 2528365
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcaccttt |
534 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||| |||||||||||| |||||| ||||||||| ||| |||| |
|
|
| T |
2528441 |
ggttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatcttt |
2528365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 476 - 540
Target Start/End: Complemental strand, 3643969 - 3643905
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtggg |
540 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
3643969 |
aacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtggg |
3643905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 10026716 - 10026632
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | |||| ||||||| ||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
10026716 |
ggttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtc |
10026632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Complemental strand, 10046576 - 10046493
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| | ||||||||||| |||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
10046576 |
ggttcgattctcaagggaaacaacgtttga-cagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtc |
10046493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 458 - 542
Target Start/End: Original strand, 10669598 - 10669682
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||| ||||||| ||| ||||||||||| ||||||||||| ||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
10669598 |
ggtttgattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtc |
10669682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 459 - 555
Target Start/End: Original strand, 16325602 - 16325698
Alignment:
| Q |
459 |
gttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| |||| |||||| |||| ||||| |||||||||||||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
16325602 |
gttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcg |
16325698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 476 - 548
Target Start/End: Original strand, 38962787 - 38962859
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaac |
548 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | |||||||||| |||||||||||||||| |||| |
|
|
| T |
38962787 |
aacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggtgggtcagaaac |
38962859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 541
Target Start/End: Original strand, 331507 - 331590
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||||||||||| |||| |||||| |||| |||||||||||| ||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
331507 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacctttggtgggt |
331590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 3811791 - 3811700
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||||| | || |||||| |||| ||| ||||||||||||||||||| || ||||| ||| |||||||||||||||| ||||| |
|
|
| T |
3811791 |
ggttcgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaacc |
3811700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 460 - 555
Target Start/End: Original strand, 12864232 - 12864327
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||| || |||| |||||| |||| ||||||||||||||||| ||||| || |||||||||| |||| |||||||||| ||||| ||||| |
|
|
| T |
12864232 |
ttcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcg |
12864327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 460 - 542
Target Start/End: Complemental strand, 39201606 - 39201524
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||| | |||| ||||| | ||| ||||| |||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
39201606 |
ttcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtc |
39201524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 547
Target Start/End: Complemental strand, 3849014 - 3848925
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaa |
547 |
Q |
| |
|
||||||||| | |||||||||||| ||| ||| ||||||| ||||||||| ||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
3849014 |
ggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctttgatgggtcgaaaa |
3848925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 7747280 - 7747377
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| || | ||||||| ||| ||||| |||||||||||||||| || |||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
7747280 |
ggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcg |
7747377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 14169709 - 14169612
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||| | |||| |||||| ||||| ||||||||||| |||||||||| || |||||||||| ||| |||||||||| ||||| ||||| |
|
|
| T |
14169709 |
ggttcgattctccgggggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcg |
14169612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 18902630 - 18902533
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||| || ||||||||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
18902630 |
ggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcg |
18902533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 539
Target Start/End: Original strand, 38005408 - 38005489
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgg |
539 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||||||||| ||| || ||||||||| |||||||||||| |
|
|
| T |
38005408 |
ggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgg |
38005489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 39806985 - 39806888
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| | ||||||||| ||| |||||||||||||||||| || ||| |||||||| | |||||||||||| ||| ||||| ||||| |
|
|
| T |
39806985 |
ggttcgattcccaagagaaacaacgtttggccagtgcgcatgcctctacacacgagtcggattagtcatccacctttggtggttcataaaccggtgcg |
39806888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 41032006 - 41031909
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||| ||||||||||||||| || |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
41032006 |
ggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccacctttggtgggtcggaaaccagtgcg |
41031909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 547
Target Start/End: Complemental strand, 45263767 - 45263678
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaa |
547 |
Q |
| |
|
|||||||||||| | || ||||||||||| ||||||||||||||||||||| || ||||| ||| ||| |||||||||||| |||| |
|
|
| T |
45263767 |
ggttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggtcgaaaa |
45263678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 489 - 541
Target Start/End: Complemental strand, 18649095 - 18649043
Alignment:
| Q |
489 |
cagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||| |||||||||| |
|
|
| T |
18649095 |
cagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggt |
18649043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 458 - 554
Target Start/End: Original strand, 24179575 - 24179670
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgc |
554 |
Q |
| |
|
|||||||||| | |||||| ||||| ||| |||||| ||||||||||||||| || |||||||||| || ||||||||||| ||||||| |||| |
|
|
| T |
24179575 |
ggttcgattctcaggggaa-caacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtgggttaaaaaccggtgc |
24179670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 471 - 555
Target Start/End: Complemental strand, 34346374 - 34346290
Alignment:
| Q |
471 |
ggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| |||||| |||| ||||| |||||||||||||||| ||| ||||| ||| |||||||||||||||| ||||| ||||| |
|
|
| T |
34346374 |
gggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcg |
34346290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 8410137 - 8410188
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
8410137 |
ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgca |
8410188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Original strand, 37560179 - 37560270
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
|||||||||| | ||| ||||||| ||| |||||||||||||||||||||| || ||||| |||| |||||||| |||||| |||||| |
|
|
| T |
37560179 |
ggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaacc |
37560270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 475 - 510
Target Start/End: Original strand, 41187872 - 41187907
Alignment:
| Q |
475 |
aaacaacgcttgatcagtgcgcatgcctctacgcat |
510 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41187872 |
aaacaacgcttgaccagtgcgcatgcctctacgcat |
41187907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 549
Target Start/End: Complemental strand, 42770751 - 42770660
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaacc |
549 |
Q |
| |
|
||||| |||| | |||| ||||||||||| |||||||||||||||| |||| || ||||| |||| ||||||||||||||| |||||| |
|
|
| T |
42770751 |
ggttcaattctcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaacc |
42770660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 458 - 509
Target Start/End: Original strand, 44139490 - 44139541
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
44139490 |
ggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgca |
44139541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 534
Target Start/End: Original strand, 10106612 - 10106670
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcaccttt |
534 |
Q |
| |
|
||||||||||||| || |||||||| |||| |||||||| |||||||||| ||||||| |
|
|
| T |
10106612 |
aacaacgcttgattagcgcgcatgcttctatgcataagtcggattagtcgtccaccttt |
10106670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 10823066 - 10823163
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||| ||||||| || | ||||||||||| ||||||||||||||||||||| || ||||||||| ||||||| ||||||| ||||| ||||| |
|
|
| T |
10823066 |
ggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcg |
10823163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 460 - 509
Target Start/End: Original strand, 29653635 - 29653684
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
||||||| || ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
29653635 |
ttcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgca |
29653684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 34356212 - 34356309
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || |||| |||||| |||| |||||||||||||||||| |||| || ||||| |||| |||| ||| |||||| |||| |||||| |
|
|
| T |
34356212 |
ggttcgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggattaatcgtgcaccattgatgggtcggaaacgagtgcg |
34356309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 541
Target Start/End: Original strand, 16888 - 16971
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggt |
541 |
Q |
| |
|
||||| |||| | |||||||||||||||| |||||||| ||| ||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
16888 |
ggttcaattctcaggggaaacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggt |
16971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 476 - 535
Target Start/End: Original strand, 12600 - 12659
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttg |
535 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
12600 |
aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttg |
12659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 555
Target Start/End: Original strand, 68526 - 68620
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
|||||||||||| |||| ||||||||||| ||||||||||||||||||| || ||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
68526 |
ggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcg |
68620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 458 - 509
Target Start/End: Complemental strand, 271174 - 271123
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgca |
509 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
271174 |
ggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgca |
271123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 460 - 542
Target Start/End: Complemental strand, 155809 - 155727
Alignment:
| Q |
460 |
ttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtc |
542 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
155809 |
ttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc |
155727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0316 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0316
Description:
Target: scaffold0316; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 1714 - 1617
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||| || |||| ||||||| || |||||||||||||||||||||| || |||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
1714 |
ggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcg |
1617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 458 - 555
Target Start/End: Complemental strand, 42932 - 42835
Alignment:
| Q |
458 |
ggttcgattccctggggaaacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcacctttggtgggtcaaaaaccagtgcg |
555 |
Q |
| |
|
||||||||||| ||| ||||| ||||| ||||||||||||||||||| ||| || ||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
42932 |
ggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcg |
42835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0635 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0635
Description:
Target: scaffold0635; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 476 - 534
Target Start/End: Complemental strand, 2172 - 2114
Alignment:
| Q |
476 |
aacaacgcttgatcagtgcgcatgcctctacgcataagtatgattagtcgttcaccttt |
534 |
Q |
| |
|
||||||||||||| || |||||||| |||| |||||||| |||||||||| ||||||| |
|
|
| T |
2172 |
aacaacgcttgattagcgcgcatgcttctatgcataagtcggattagtcgtccaccttt |
2114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University