View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15911_high_16 (Length: 257)
Name: NF15911_high_16
Description: NF15911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15911_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 3 - 200
Target Start/End: Original strand, 399712 - 399910
Alignment:
| Q |
3 |
atatcccaaaagaaggaccactttattttactcttgttctcttaaaaatgat-caatttcattttttgttgctatgctgaaagtatagactttatctttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
399712 |
atatcccaaaagaaggaccactttattttactcttgttctcttaaaaaaaattcaattttattttttgttgctatgctgaaagtatagactttatctttc |
399811 |
T |
 |
| Q |
102 |
acttacaaaataaagaacttattttttgtgtttgacgttgaaatttaaacttgttttaaagtcaaccaaactataacaagccaatggcatatgaaccca |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
399812 |
acttacaaaataaagaacttcttttttgtgtttgacgttgaaatttaaacttgttttaaagtcaaccaaactataacaagccaatggcatttgaaccca |
399910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 195 - 238
Target Start/End: Original strand, 399929 - 399972
Alignment:
| Q |
195 |
aacccaagtgatgctttcatcgcaaatcaatctgtctcatatgg |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
399929 |
aacccaagtgatgctttcatcccaaatcaatctgtctcatatgg |
399972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University