View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15911_low_10 (Length: 349)
Name: NF15911_low_10
Description: NF15911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15911_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 140 - 252
Target Start/End: Original strand, 45588062 - 45588174
Alignment:
| Q |
140 |
aatctagttagtagtcattaattaagctggtgattatgtattaagaaatcacaaaggtaaatagcgcaaatttgtttgacgtgccacttatgcaggatgc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588062 |
aatctagttagtagtcattaattaagctggtgattatgtattaagaaatcacaaaggtaaatagcgcaaatttgtttgacgtgccacttatgcaggatgc |
45588161 |
T |
 |
| Q |
240 |
cacatgatctggt |
252 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45588162 |
cacatgatctggt |
45588174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 32 - 108
Target Start/End: Original strand, 45587905 - 45587981
Alignment:
| Q |
32 |
ttgaacaataaatttttatagtgattttgatatttaatatgtgcattgaaaattaaattatttgactttttcaataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45587905 |
ttgaacaataaatttttatagtgattttgatatttaatgtgtgcattgaaaattaaattatttaactttttcaataa |
45587981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 296 - 335
Target Start/End: Original strand, 45588222 - 45588261
Alignment:
| Q |
296 |
cccttaattaatgcaaaattattcctttgcagaaaaaggt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588222 |
cccttaattaatgcaaaattattcctttgcagaaaaaggt |
45588261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University