View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15913_low_8 (Length: 238)
Name: NF15913_low_8
Description: NF15913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15913_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 18267565 - 18267766
Alignment:
| Q |
19 |
aattggagcaatcttgtgtattaatatctcctctacattgagctaagccataaactttttctttgctattaccatatgttgtagcaacaaagaaagttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18267565 |
aattggagcaatcttgtgtattaatatctcctctacattgagctaagccataaactttttctttgctattaccatatgttgtagcaacaaagaaagttga |
18267664 |
T |
|
| Q |
119 |
aggagtttgaagggctaattgagacaatagtttatcaatattagttgataattttcctccagtgctaatgtttgtgtttttattgcaaaattcccctaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18267665 |
aggagtttgaagggctaattgagacaatagtttatcaatattagttgataattttcctccagtgctaatgtttgtgtttttattgcaaaattcccctaaa |
18267764 |
T |
|
| Q |
219 |
gg |
220 |
Q |
| |
|
|| |
|
|
| T |
18267765 |
gg |
18267766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University