View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15914_low_5 (Length: 381)
Name: NF15914_low_5
Description: NF15914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15914_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 20 - 311
Target Start/End: Original strand, 41896106 - 41896397
Alignment:
| Q |
20 |
cttatccaccacaaacaactgaggataattataacaccatatctaaattcattgagcttccttacacaactgatcatcaagacaaaactacaagtgctat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896106 |
cttatccaccacaaacaactgaggataattataacaccatatctaaattcattgagcttccttacacaactgatcatcaagacaaaactacaagtgctat |
41896205 |
T |
|
| Q |
120 |
ggagcttctgaaaactgcttcttcatcaaggggtttgaattcttttatgcctatgactttgtctgagtctagtgcaatgtataattcaagtggctttgct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896206 |
ggagcttctgaaaactgcttcttcatcaaggggtttgaattcttttatgcctatgactttgtctgagtctagtgcaatgtataattcaagtggctttgct |
41896305 |
T |
|
| Q |
220 |
ttgcaagattttaagcttggggtcaattttggcttagaagggtttgagaatggttatggtggtttacaagggattaataatcaagagggttc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41896306 |
ttgcaagattttaagcttggggtcaattttggcttagaagggtttgagaatggttatggtggtttacaagggattaataatcaagagggttc |
41896397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University