View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15914_low_6 (Length: 375)
Name: NF15914_low_6
Description: NF15914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15914_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 21 - 365
Target Start/End: Original strand, 28325315 - 28325662
Alignment:
| Q |
21 |
gatccaattgtggataagcttagaactcagttgggtgtgattcacccgattccatcgcctcctattaaccgaaacgttgctggtttgtttgtgnnnnnnn |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28325315 |
gatccaattgtggataagcttagaactcagttgggtgtgattcacccgattccatcgcctcctattaaccgacacgttgctggtttgtttgtgttttttt |
28325414 |
T |
|
| Q |
121 |
nctttggtggtgttgtttttgataaattatggactttcagaa---ggaggaacaaagttagtagtgaagatagtttccgcggtgtgtggccgcaggttcc |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28325415 |
tctttgttggtgttgtttttgataaattatggacttttagaagaaggaggaacaaagttagtagtgaagatagttttcgcggtgtgtggccgcaggttcc |
28325514 |
T |
|
| Q |
218 |
tactagtttttcgttgtttttggagaaggatttgcagaggaaagagtcagttgaatgggtgaacatggtgttagggaagttgtggaaggtttatagaggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325515 |
tactagtttttcgttgtttttggagaaggatttgcagaggaaagagtcagttgaatgggtgaacatggtgttagggaagttgtggaaggtttatagaggt |
28325614 |
T |
|
| Q |
318 |
ggacttgagaattggattattaggttacttcaacctgttattgatgat |
365 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28325615 |
ggacttgagaattggattattgggttacttcaacctgttattgatgat |
28325662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University