View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_high_24 (Length: 407)
Name: NF15916_high_24
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 7896246 - 7896637
Alignment:
| Q |
1 |
acattatcaaatttcatgtctgttaaccattgaatggcatgaaacagccccatggcttctccaacatcaacagcaagttgtgtgggaaatctccttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896246 |
acattatcaaatttcatgtctgttaaccattgaatggcatgaaacagccccatggcttctccaacatcaacagcaagttgtgtgggaaatctccttgttt |
7896345 |
T |
 |
| Q |
101 |
gcgcaagtacatacgtaccgttgtcatcacgcaaacaaacaccaataccgttacggttccacaccgaggaaaaagcggcgtcaatgttgcatttgaaacg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7896346 |
gcgcaagtacatacgtgccgttgtcatcacacaaacaaacaccaatacccgtacggttccacac-gaggaaaaagtggcgtcaatgttgcatttgaaacg |
7896444 |
T |
 |
| Q |
201 |
accctgctgcggtttctgccatacacatgcatttgcctgtacagactgtcggtgctgatctgctcgtgaaccgtgtgaaaccgaggaatgagtcgaagtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7896445 |
accctgctgcggtttctgccatacacatgcattttcctgtacagactgtccgtgctgatctgctcgtgaaacgtgtgaaaccgaggaatgagtcgaagtt |
7896544 |
T |
 |
| Q |
301 |
gtattcaccgatacccaaccctccataaggttttgagctctaaaaatcacttgggcagccgtctcattttcattttgccatagcttgttattg |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7896545 |
gtattcaccgatacccaaccctccataaggttttaagctctaaaaatcacttgggcagccgtctcgttttcattttgccatagcttgttattg |
7896637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University