View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_high_50 (Length: 212)
Name: NF15916_high_50
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_high_50 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 1599037 - 1599249
Alignment:
| Q |
1 |
tcatgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtcaaaagctgtcatcagtgtc---atgcttaaaatccgaaactaggactgttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1599037 |
tcatgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtcaa--gctgtcatcagtgtcgtcatgcttaaaatccgaaactaggactgttt |
1599134 |
T |
 |
| Q |
98 |
atggttcatttcatgaggaaaatcaaattcaaatgttgcaacagttttataaaactgaactgaaccgttaaccgtttgctctgaaccgaattgatatgaa |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599135 |
atggttcgtttcatgaggaaaatcaaattgaaatgttgcaacagttttataaaactgaactgaaccgttaaccgtttgctctgaaccgaattgatatgaa |
1599234 |
T |
 |
| Q |
198 |
ggttgaatgtaggtt |
212 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1599235 |
ggttgaatgtaggtt |
1599249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 4 - 165
Target Start/End: Complemental strand, 41222622 - 41222463
Alignment:
| Q |
4 |
tgtagtgtcttttattgtgtggttggtgttaatatgactatgtgtcaaaagctgtcatcagtgtcatgcttaaaatccgaaactaggactgtttatggtt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| ||| || || ||||||||| ||||||| ||| |||||||||| ||| |||||| |
|
|
| T |
41222622 |
tgtattgtcttttattgtgtggttggtgttaatatgaccatgtttcat--gccgttatcagtgtcgtgcttaatatctaaaactaggaccgttcatggtt |
41222525 |
T |
 |
| Q |
104 |
catttcatgaggaaaatcaaattcaaatgttgcaacagttttataaaactgaactgaaccgt |
165 |
Q |
| |
|
| ||||| || |||||||||||| || ||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
41222524 |
cgtttcaagaagaaaatcaaattgaactgtaacaacagtttcataaaactgaaccgaaccgt |
41222463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University